archive-edu.com » EDU » B » BCM.EDU

Total: 567

Choose link from "Titles, links and description words view":

Or switch to "Titles and links view".

  • TATATAGTTATCTTTACCAGTAAACTTCATATTTTCATAAGCTTTAGCAT TGCTGTTTCGAAACTTTTGGTTCAATTTGAAAATTCCCTTTAACATTTCT TATAAACACATCATGGTGATAAACTCACTCAACTTCTGCTTATCAAGAAA AGTCCTTATATTTCCTTCATTTTTGAAAAATAATTTTGCCAAATATAGTA TGCTTAGTTGGCAGGTTTTTTCCAATATATTATACTTGTGAATTAATATG AAGCCTAAGTAAAAGGCAACATGAAGACTTAATATAATGACTGACTTCTA AATGGTCAAATTCTTCTTTTGTTAAAAGTGGAGTGTTATATAACCATGAA GATTAATGTCATGAAGTAATAAAACATTTAGAGAACTGAAATTAAGATGT ATGATTGTTGGAGCAAATAGAAATCAATCATCATTTTATGAATTGACAAT ACATGTAAAAAAGGACATATTATACTTGTCACACTGGTACTCATATGAAG TGAATTAAGGAAATTAATGTAAAAATATACAAAAAAAGTTTAGGCTCCTT ATATAGGATTTCCTGTTTAGAGAAATATGTAGTTAGAAATTAGAATTTGA AAAAAAGTGAAAAATATTCTTCTAGAAGTACTGGTAAAAATCAGTATTTT TCTTGTTAGTTTCTCCTTTCATTCCCCTTCTGTCTCTGAAGATGATCAAA TAAAGTTTTGCCTTGCCTTGAAACTTTTCCCGTATCTTCTGGAGATGATG AAATTCATGTACAATTTGAGATACTTGTATTTTAAGACACAGTAGATTGT TAGCATGTTCGCTGTTCTCTTCAGAAGAAGACTTTAGTACGTGTTTGCTT GTGGTATTATCAAAAGGAAATGAGCTAATAGTTTATAAAAATCAACTTTT AAATTGATATTGCCTAGTTTATTAGACGGAGAAGGCAATGACACCCCACT CCAGTACTTTTGCCTAGAAAATCCCATGGACGGAGGAGCCTGGTAGGCTG CAGTCCATGGGGTCGCTAGAGTCGGACACGACTGAGCGACTTCACTTTCA CTTTCCTGCACGGGAGAAAGAAATGGCAACCCACTCCAGTGTTCTTGCCT GGAGAATCCCAGGGACGGGAAGCCTAGTGGGCTGCCGTCTATGGGGTCGC ACAGAGTCGGACACGAATGAAGCGCCTTAGCAGCAGCAGCAGCAGCAGCA GCAGTTTATTAGAGGGACTTCTCTGGTGGCTCAGCGGTAAAGAATCTGCC TGCAGTGCAGGAGACCCGACCTAGATCTATGGATTGACAAGATCCCCTGG AAGAGGGCATGGCAACCCACTCTTGTATTCTTACCTGGAGAAATGCATGG ACAGAGGCGCCTGGCAGGCTACAGTCCATGGGGTCGCACAGAGTTGGACA TGACTGAAGCAACTAAGCAGAAGCAGTAGCAGTTTATTAGAGACGTTATT CAAAATGATTATATAAATGTCCTATTTCTATTTTGTATTTTGCTATATTA ACTACCCATGGTTTAAGATGTTGATAATTTATTCTAAGGGTAATATGATA CAGTATATGCTCCCTTATTCTATGATCAGACTGTATCCTGTGATTAAAGT GTTTTGGATATCTAATTATTTCTTAAAAATAAACTGTCTGAATGACTGGG TTTAGTTAGGTAAGTTATCATATAAAACAATCTGAAGGCCAATTTTTTTC CAAAAATGTCAAGTCAGATATCTCATTTGTATTATAAACGCAGGTTCTAT AAGAATTATCATATCAAAATAATTTTTATTGTATTAAAATAACTTTCTAA TTTAATTTAATCTACATCTTTCTTAAGTTTAGGTATATTTTTGCATAATA AATAACATAAGCATATGTATAAATAAACATTACTTTTAAAACATTATTTA TCCTTTTTCCTAATTGTGTACTGTGTTTTTAAGTTGGATTTTTAAATTCA GATCAATAACATATAAATTTTCTGTAGTATCCTCATTATCCAGAAACATT CACCACTGAGCTTAGGTCTCAATCTTTTATATTTATAAGGTACACAGAGA AGTGTAAAGGTGTAGTGTTATATCCACCGGTATGGATATATGCATAGGTT TAATTACAAAATACGTTTTTACAAAAATAATATTTTTAATATATCGAGAG CTGTACTTTGATTATTGAACATATTAATTTTTCCTGTTGGCAAGTATTTT TATTTGGTTTCAATAATTATTTAATTTCCCAGTATATGACTTATCATAAA AATTTTATAAGTTCATGATATTGGATGTTTAGATTATATCAAATATTTAT ATCAAATATTTCATTTAAATAATACTGGACATCTTTATAGCTAATATGGT CACAGTTTCGCATTATTTTCTTAGAAATATATTTGCAGTGCTCATTTATC TTATCAAAATGCAAACATATTGCTTAAATCACTCCAGATAATTTATTCTT ATGTACACAAATTTAGTAATCTAATAATTTACCAATATTTCTTATTAAGA GTGTTTTCTTTAATGTAATAAATAAATATGTAAAATAATATTCTCAAAGA TATTGCATAAAATTTATGTTGATAAGTATTGAAAATAACACCATGGTATT GGTATTTTCTGGACCCTACAACCAATGTAAACACTATTGTATGGAAAAGG ACTGATACAAATATTCTTGCAAAATTCCTTGTTATTTTTAAGTGAAACAT AGATTCTATTACACTGTATTTCCTTCTACTGAAATATTGATAGCTATTCA TCACGGAGAACATCTAAAGAAGAGTAATTATTTTTGGAGTAGAGGTGAGG TAAGATGTCAGTGAGTTATAACAAGTATAAAGATAATCTTATGTTACAAT GTGGATGTTTTTCAATCTGTAGCAGTAAAAATGTCTAAACATCTTTCAAG CAGTTAAAAAAATCATTGAGTGACATCTTCATTACCTAAATAATAACAAA TCTGAACAGTAATAAACATTATAAATGTATCTAGCTATCTTTTATAGTTT CAAGTAAATATTTACAAAATTGTCTTATAAAATATTGTTAATATAAATTT TTTTTAAACTGCAACTACAAACAATGTGATTTATTTGAGTCACCACAATT TAAATGAATAAATTGAAATTATAGCCTGAACTGCTGAGGGCTATTTGCAA GAAGATTAAAGGACATACTACCACCAGGCGGTAAAAAGTGTTTATCTAGG GGAAATATTTTCAATATTTCTTACAAGTAACTACCGATCTCATTGCATTA TGGTTAAATGAGATGTGTGGTCATTAACAAAATTATACATATGTTAATTT ATTTACTGCAGCACACTTTATTTATTTTAGCATTTCAAGTACTTTCACAG TGCTTGAAAAGAAAGAGATAGAGATTGTTGTAGACTGTTGTAGACGAGGC TCTCCTGGGGGGAAATAGGTTAGTTTCTCCTGACTCTTACCTCTGAATCT GTTATTATATCTCCTCTCTGACCCTGGTGCTCCTGTCTTTCTAAGGATTC TTGAGATTTCATTGGGCAAACCTGGATAATGCAAGAGAATCTCTCCATTT CATTTTGACATATGATGCAACTTGATGAACTACNTGTACTCATCGATGCC CCCCC project fbnp AC 20040903 15324bp ATGAGGCCACCAGAAGGGATACAGTTAGTTCATCAATGAAAAAAGTCAAT GGCCATGAGTTTTATCGTGGTCCTTCAGACAATTCTCACCTGCATCAATG CATTTGAGAAAGCCCAGACACTAAATGGTTTACTATAGCTTGTGAGATAT ATTAAACAAAAAGAAAGACAAACAAACAAAAAAACCTCTAACCTAATCTA ACCTTGACTTGTAGTCAAACTTTGTATCAAGTTGATGGTGTATTCAAGTT AGTCATTTTAAAAAATATTTTGTCCACCTTTTCTATGTGTATCTAAATAT ACTATTCACGTATTTATTTCTTTAAGCACACACTGCCATTCTCATATGTG ATAAATTTTCACATTAAAACATAGTTACTACAAGAAGATAGCAATAAATC CAAGTATTCTATATAGACTATTTCTAAGCACTGACCTTTTAATTCCTAGT TTCATGTCTTTTCTCCAGGTGGGAAAAGACTTTGTATGTAAACAGAGCAT CATGTTCTTTATGTGTTCCAGCTTGTGAATTTTGCTTGAAGTTATGTGCT TTAGATGCCATCAATTCTTTTTTTTTTTCTATGTTTGCAGTAAGATAAGC TTTTAGCTATAGTTAGCAGTACTCTCTAATACATCTGTGAAGACAATATC TTCTCCTTGTACTCCTTGCAAGGGTCAAATGAACTGAAACCTACCTAAAT CAGCAGGCAACACAGAACTTATGTTCGTCTATGTCTACCATATAATGTTT TTATTTTAGAATAGATCTTTCAGGTTTTGTGTATCTTTTTAAATAATATC TACCTACAATTTGGCTAAGGAAATTAAAAATCACAGAGTTTATGATTTTT TGTAAAACCTCACTTCCCTTCCCCTCTTTGCTAATTTCCAAACGAGTAAA TTTTCTTACTGTGTATATTTTCTCTCTTAATCTCTGTTTTCAGAGGTACT ACATCTAAAACCTAGTGGCTAATCTCCAAAATTTCTACATAACAAGAGAA GACATTTTAGAACTCCCCAAGATGCCAATAAGGATACTAATATTCTTGTG TATAGCATTGATACTAGAAAGTAACAAGTCATTAATTTTCACCTTTCAAA CTACAATACATCAATGTTTTCTGATTGCTCTGTGACCACAGAGGAGGTCT CATAGTCTTTAACTTTTCAAACTGCTATCTTCCCTACACCTGTATAGAAT GCCATGCTAACACTTCATCATAACTGAGGTTGAGGGGGCTGTCTTTGAGG ATGGGTGAGTGGCCCAGCTGGTTAAGAGTCCACTTGCAATGAAGGAGACC TGGGATCAATCCATGGGTTGGGAAGATTCCCCTGGAAAAGGAAATGGCAA TCTACTCCAGTATTCTTGACTGGAAAATCCCAAGGACAGAGGTGTCAGGT GGGCTACAGTCCATGGGGCTGCAAAGAGTCTGACAGGATTTTGTGACTAA AACCACCAGGAATCTTGGGTCTGCTCTGTCCTGTCACTGCCTTGTTACTG ATAACTTTGTTGCCAATAAATTCTGCTGCATTGTTCCATACACAGATGGA AATAGAGACCCATTCCATAATCAATGCTTTGTTGTTGTTGTTGTTGTTGT TGTTGTTGTTGTTGAGTCCGTCAGTTCAGTCTTTATGGGACCCCAAGACT GGAGCATGCCAGGCTTCCCTGTCCTTCACTATCTCCAATAGTTTGCACAA ACATGTTCATTTAATCAATGATGCCATCCACCCATCTCATCCTCTGTAAC CCCCTTCTCCTCCTGCCCTCAGTCTTTCCCAGCATCAGGTTCTTTTCCAA TGAGTCAGTTCTTCTTATCTGGTAGCCAAAGTATTGGAGTTTCAGCTTCA GTATCAGTTCTTCCAATGAATATTCAGGACTGATTTCCTTTAGGATGGAC TGGTTGGATCTCCTTGCAGTCTAAGGGACTCTCAGAGCCTTCTCCAACAC TACAGTTCAAAATAATCAATTCTTCTGCACTCAGCTTTCTTTATAGTACA ATTCTCACATCTGTACATGACCACTGTAAAAACCATAGCTTTGACTAGAT GGACCTTTTTTGGCAAAGTAATGTATCTGCGTTTTAATATGCTGCCCAGG TTGGTAATAACTTTTCTTCCAAGGAGGAAGGGTCTTTTAATTTCATAGCT GCAATCACCATCTGCAGTGATTTGGGAGCCCAGAAAAATAAAGCCAGCCA CTGTTTCCACTGTTTCCCCATCTATTTGCCATGAAGTGATGGGCCTAGAT GCCATGATCTTAGTTTGCTGAATGTTGAGTTTTAAGCCAACTTTTTAACT CTCCCCTTTTACTTTCATCAAGACGCTCTTTAGTTCTTCATTTTCTATCA CAAGGGTGGTGTCATCTGCATATCTGAGGTTATTGATATTTCTCCTGGCA ATATTAATTCCAGTTTGTGCTTCATTCAGCCCAGTATTTCTCATGATGTA CTCTGCATATAAGTTAAATAAGCAGGATGACAGTATATAGTCTTGATGTA CTCCTTTACTCATTTGGAACTAGTCTGTTGTCCCATGTCCAGTTCTAATT GTTTCTTCTTGACCTGCATACAGATTTCAGAGTAGGCAGGTCAGGTAGTC TGGTATTCTCATCTCTTTAAGAATTTTCCACAGTTTGTTTTGATCCACAC AGTCAAAGGCTTTGGCATAGTCAATAAAGCAGAAATAGATGTTTTTATGG AACAAAGACTAAGTCTAAGGCTTAAAAATATAGATTCACCTTTGTCTCAA GCAAAAGAAATATGAAGGAAATGTCCCAGGCCAAATAGACATTCTGTGCT AATGTTGGGACTTCTTCATCCTCACCAGTGCCTCTCTAAAAGATGAAAGG CTATCAAAATTACATAGAAAGCAGTGGGAGGGAAGTCTGAGGAAGTGTGT GATAGTTTGAGGAACTGTTCAGTAAATTATTATTCAATGTCTCTTCTCAC TCTGGGCAGATTGTGCTGTTCTTGTTGCTTTTCAGTCTCAAAGTTGTCAT GACTATTTGTGACCTCATGGACTGCAGCACTCTTGTTCTCCACTATCTCC CTGAGTTTGCTCAGATTCAGGTCCACTGAGTCAGTGATACTATCTAACCA TCTCATCCTCTGCCACCTCTTTCTCCTTTTGCCTTCAATTTTTCCTAACA TTGAAATCTTTTGCAGTGAGCTGACTCTTCACATCAGGTGGTTAGGCTTA ACCTTCAGCTTGCTTTGGTTAATGAATACCAGCATATGCCAAGGCCAGGT TTCAGGTGTCTTCTGTTTGGAGTCTGGATCCAGAATAATTGAATGTAAAG TAGAAAAATTGTACTCAGTTTTGATCCAAGCTCAGCTCAAGAATATCCAC CAAAATGGGTCCAGCCCCAACCAATTGAACTGGAGATCTCTGCAGCACCA AGATGAGGAGTAGAATCAGATCAGATCAATCGCTCAGTCGTGTCCGACTT TTTGCGACCCCATGAACCGCAGCACGCCAGGCCTCCCTGTCCATCACCAA CTCCCGGAGTTCACCCAAACTCACGTCCATCGAGTCAGTGATGCCATCCA GCCATCTCATCCTCTGTCGTCCCCTTCTCCTCCTGCCCTCAATCCCTCCC AGCATCAGAGTCTTTTTCAATGAGTCAACTCTTAGCATGAGGTGGCCAAA GTACTGGAGTTTCAGCTTTAGCATCATTCCTTCCAAAGAAATCCCAGGGC CGATGGAGTAGAAGGACATGCACTAATCTTATCCTGCTAGCACTCCAAAA TTGCCATTCACTGCTGAGCAATCATCGACAGCAGAATGTTGGATCCCACA AAAAAAGATACCCCACCTCCAAGGGCAAAGGAGAAGTCCCAGCAAGATGG TTGGAGGGGTGAAACTGCATTTAGAATCAAACCCCATACCCACCAGAGAT GCTCAGAGGGCTCAAACAAAACCTTGAGTGCACCAGGAGACCCCACAGAG ACTGAGCCAGACATGCCTTTGAATGTTTGAGTGTCTCCTATGGAGGTACG GGTCAGCAGTGGCCTGCCGTATGGGTACTGGCTCTGGGTGAAGAAGACCT AGGTATGGCCTAAGTCCTCTTGGAGAATATTGCCATTAACCCCACAATAG AGCCGCCAGGACAGATTCTTGGAGGACACAAACAAAATCTTGTGCACACC AGGACACAGGAGGAAAGAGCAGTGACCTCACAAGAGACTGATCCAGTCTT ACCCATGAGTGTCCTCAGGAATCTCCAGTGGAGGCATGGGCAACAGTGGC CTGCTGCACAGTTGGGGGCCCTGACTATGAGAGTGTGTGCACAGGACCAT TTGAAGAAGGTCACCATTATCTTCATTACCTCTACCATAGTTTGGCCTTA GGTCAAGACAGGAAGGGACCACAGCCCTGCCCATCAGAACAAGACCCAGT TTCCTCCTCAGTCAATCTCTCCCTTCAGGAAGCTTCCCTAAGCCTCTTAT CCTATCCATCAGAAGGCAGACAGAATGAAAACCACAGTCACAGAAAACTA ATCAAACTGATAAATAAGCCATAGCCTTGTCTAACTCAATGAAACTATGA GCCATGCCATGTAGGGCCACCCAAGACAGACAGGTCATGGAGGAAAGTTC TGACAAAACTTGGTCCACTGGAGAAGGGAACAGCAAACCACTTCAGTATT CTTGCCTTGAGAACCCCATGAACAGTATGAAAAGGCAAAAAGATAGGACA CTGAAAGATGAACTCCCCAGGTTGGTAGGTGCCCAATATGCTCCTGGAGA AGAGTGGAGAAACAGCTCCAGAAAGAATGAAGAGATGGGGCCAAAGAAAA AACAACACCCAGTTGTGGATGTGACAGATGATGGAAGTAAAGTCCAATGT TGCAAATAACAGTATTGCATAGGAACCTGGAATGCTAGATCCATGAATCC AAGTAAATTAGAAGTGGTAAAACAAGATGACAAGAGTGAACTTTGATATT TTTGGAATCAGTGAACTAAAATGGACCTGGATGGGTGAATTTAACTCATT TGAACATTGTATCTACTACTATGGGCAAAAATCCCTTAGAAGAAATGGAG TAGCCATCATAGTCAGCAAAAAGAGTCCAAAATGCAGTACTTGGATGCAA TCTCAAAAACGACAAAATGATCTCTGCTCATTTCCAAGTCAAACCATTCA ATTTCACAGTAATCCAAGTCTATCCCCAGAACAGTAACACTGAAGAAGCT GAAGTTGAACACTTTTATGAAGACCAACAAGACCTTCTAGAACTAACACC CAAAAAAGATGTCCTTTTCATTATAGGGGACTGGAATGCAAAAGTAGGAA GTCAAGAAACACTTGGAATAACAGGCAAATTTGGCCTAGGAGTACAGAAT GAAGCAGGGGAAAGGCTAATAGAGTTTTGCCAAGAGAATGCATTGCTCAT AGCAAGCACCCTCTAACAACAACACAAGAGAAGACTACACATGGACATCA CCAGATGGTCATTACTTAAATCAGATTGATTATATTCTGTGTAGCCCAAG ATGGAGAAGCTCTATACAGTCAGTAAAAACAAGACTGGGAGCTGACTGTG GCTCAGATCATGAATTCCTTATTGCCAAATACAGTCTTAAGTTGAAGAAA GTAGGGAAAACCACTAGACCATTCAGGTATGACCTAAATGAAATATCTTA TGATTGTACAGTGGAAGTGACAAATAGATTCAAGGGATTCAATCTGATAG ACAGAATGCCTGAAGAACTATAGACAGAGCTTCATGACATTGTATAGAAA GCAGTGATCAAGACAGCTCCAAGAAAAAGAAATGCAAAAAGGCAAGATGG TTGTCTGAGGAGGCCTTACAAATAGCTGAGAAAAAGAAGAGAAGCAAAAA GCAAAGGAGAAAAGGAAAGATATACCCATTTGAACGCAAAGTTCCAAAGA ATAGCAAGGAGAGATAAGAAAGCCATCCTCAGTGATCAATGCAAGGAAAC AGAGGAACACAATAGAATGGGAAAGACTAGATTTCTCTTCAAGAAATTTA GAGATACCAAGGAACATTTCATGCAAAGATGGGAACAATAAAGGACAGAA ATGGTGTGGACCTAACAGAAGCAGAAGGTATTAAGAAGAGGTGGCAAGAA TACATGGAAGAACTCTACAAAAAAGATCTTCACGACCCAGAAAATCATGA TGGTGTGATCACTCACCCAGAGCCAGACATCAAGGAATGTGAAGTAAGTG GGCCTTAGGAAGCATCACTACAGACAAAGCTAGTGGAGGTGATGGAATTC CAGTTGAGGAGAAGGGTACAACAGAAGATGAGATGGTTGCATGGCATCAC TGAGTGGATGGACATGAATTTGAGTAAGCTCCAGGAGTTGGTTATTGACA GGGAAGCCTGGCATGCTGCAGTCCATGGAGCGACACAATGTCAGACACGA CTGAGTAATTGAACTGTACTGAACTGACTCTCTGTATTTGAAAAGTAAAT TCTTAGTTTTGAATATCAGTAAGTTTTGAATTTGTCTCCCCCAGTGACTC GGTGTTAAAGAGTTCGCCTGCAACATAGGAGACACAGGTCTATCCCTGCA TCAGGAAGGTTGCCTGGAGAAGGCAATAGAAAGCCACTCAAGTTTTCTTG CCTGGGAAATCCTAAGTACAGAGTAGCCTGTTTGGCTATTGTCCTTATGG TCACAAAGAGTCAAACACAACAACTAAAAAACAACAACAAATTTTGAGGT TGCTTATTACAGACAACCTTAGTTGACTAATCCAGAGTGTTCTACCTCCA ACATCCTGCATATATTCTTATTATCATTTATTTACTTGCTAAAACCACAT AGGTGCATAAATGTCCATAACTACTGATCCAAAGCAGTCCCTAAATGCTC TTACACAAGCCACACCTCGGCCAGTGATTTATCTCAGTAATTTCAGAAAT CAACACCTACCAAGAATTTTAATTTCTTTGCTCACTTAATTCTAGAAGAA ACTTATAGAAATTACTTATATCTTTTCTGTGCTTTTAATCTCAATCTGCT ACTTTTCCACCTAGCTGCTTTTGTCTAATATTTCCAAATTCCTCTCTAGA AACTTTCAAATTTTAAAACAAAGTGGCTCTGTAACTTCAACTCTTCCCTG AACATCCTTGAGTTATGGTTGTAGTTGTTGCTGTCCCCCCCAAGCAAAAG TTATCACTTTCCTCAAAGGCTTCCTTCCTTTACTATGACATGTGTGTGTC TACTTTTTATGTTATTAATGGATATCTCTAAACAGTGAGCTCAGGAATAA ATATACTTATGCTTATTGCTTTATATATTTTTCCATAACCACCACTTCTC TACAGTGCAGATGGACTTCCCTGGTTGCTCAGTGGTAAAGAAGCCACAGG AGATTTGGGTTTGATCCCTGGGTAGGGAGGTTCCCCTGAAGAATGAAATG GCAATCTATTCCAGTATTCTTGTCTGGGAAATACCATGTATGGAGGAGCC TGGTGAGCTACAGTTCCACAAGGTTGCAAAGAGCTGGACACAACTCAACA ACCAAACAATAACAGTACAGATGTAGTGCATGCTATTGAAAAAGATATTA AATGACCTGGAAAAATGCAAAAAGCTTTTAGCCTTCTTTATGTATTAAAA TCACAAAGTAATTATTTCAATTACTTTGCTAGTGTTAACATTACTTGCTT TAGGATTTAAAAGAGCTTTTGATTAATCTGTCATTATATTTTAAATTTTA AAATAAAATATAAAGCCCAATAGATTCAGTAAGAATCATAGGAATTTTAA TTTTTAGTATCATCAATGTTGCTGATGGCAAATTGGAAAGTCTATTTAAA ATGCTGACCCTTTGAGAGTTAGCAAAAGATATATTAATTAGGAATTTTCA GTTCTTGAACCATTAATTCTGTTCTTTATAAATATATTGGAAAATATTCA TTTAATACTTCAGCAGTTTTATTGTCCTTGCTATCTTATTTCTCATTTCA TGCCAGAGAACTCTAATTTCTTCCTTGATTAGCCCTTGCTGTGATAATAA TGAAAAACTATTTTAATTATAAGAAATCTTTATCCATAAGGATTTGATAA CTTTTTTATTTTGATTTTTATTGTCCTTCTGATTCCCACCATCATGTTAT TTCCACATTTATTTAAATGTTATTGTCTTTTTCTAAAATGAGAATTAACA TCTTTTAGTTTATTTTTAATTTGTTCAATGAGGTACACTTATTGCTTTTC TTTTTTCTTAGAAATGATTTATAATAATTCATTGGTTCATACGTATATAG TCAGTTCAGTTCAGTTCAGTTTAGTCACTCAGTCGTGTCTGACTCTTTGC AACCCCATGAATTGCAGCATGCCAGGCCTCCCTGTCCATTACCAACTCCC AGAGTTCACTCAGACTCACGTCCATTGAGTCAGTGATGCCATCCAGGCAT CTCATCATCTGTCATCCCCTTCTCCTCCTGCCCCCAATCCCTCCCAGCAT CAGAGTCTTTTCCAATGAGTCAACTCTTCGCATGAGGTGACCAAAGTGCT GGAGTTTCATTTTAGCATCATTCCTTCCGAAGAAATCGCAGGGCTGATCT CCTTCAGAATGGACTGATTGGATCTCCTTGCAGTCCAAGGGACTCTCAAG AGTCTTCTCCAACACCACAGTTCAAAAGCATCAATTTTTCAGCGCTCAGC CTTCTTCACAGTCCAACTCTCACATCCATACATGACCACTGGAAAACCCA TAGCCTTGACTAGATGGACCTTTGTTGGCAAAGTAATGTCTCTGCTTTTG AATATGCTATCTGGGTTGGTCAGAACTTTTCTTCCAAGGAGTAGGCAACT TTTAATTTCATGGCTGCAGTATATATATGGTGATATACAACATCTAAGAC TCAAATCACGTTTGCACAAAATACAAATTTTTGAGCTGATTATGATTCAC TCCAGATTCAAATTGCTTTATTGGCTTCCCAGACCTCATGTGCTATTAGT AAGTAGCAATATTCCTGCCATAGCTCCCAAAGACTTTAGCAGGTGCAGAA CTATTCTTCTACCACTCTTTATATTGCAGGCCCATTGGGCTCTAATCAAT GTTTTAACATGCCACCCACTCTCCAAATTCAACTACTATTCATGATTAAA CTTTATCCAGTTTGTTATTATTGTTGTTCAGATGTTCAGTCATAGGGCAC AGAAAAAGGTACTGTACTTCGATTCTTAAGTTTTTAACTGTTATGGATGG AATTATCCTCTCCCAAATTGACATGCAGAAGTCCTAAACTCCAATGTGAC TGTATTTGCCTAGAGGGTCTTTAAGGAAATTTGTTGTTGTTGAACAGTCA CTCAGTTATATCCGACTGTTTGTGAAACCATGGACTCCAGGCTTCCCTGT CCTTCAACATCTCCCAGATTTTGCTCAAACTCATGCCCATTGAGTTGGTG ATACCATTCAAAAATTTCATCCAGTCGTCTCCTTCTCCTCCTGCCTACAA TCTTTTCCACCATCAGAGGCTTTTCTAATCAGTTGGCTCTTAGCATTAGG TGGCCAAAGTATTGGAGCTTCAGTTTAAGCTCCAGTCCTTTCAATGAATA TTCAACGTTGATTTCATTTAGGATTGACTAGTCTGATTTTCTGGCAGTCC AATAGACTCTCAAGAGTCTCCTCTGACACTACAGTTCAAAAGGATCAATT TTTCTGTGCTCAGCTTTCTTTATAGTCCAGCTCTCATTCATACAGAGTCA TCCATACATGACTACAGGAAAAACCATAGCTTTGACTAAATGGACCTTTG TCGTCCAAGTAATGTCTCTGCTTTTTAATATTCTGCCTAGGTTGGTCATA GGTTTTCTTCCAAGGAGCAAATATTTTAATTTTATGGCTGTAGTCACCAT CTGCAGTGATTCTGAAGCCCAAGAAAATAAAGTCTGTCAACACTTCCATT GTTTCCCCAACTATTTGCCATGAAGTGATGGGACTGGATGCCATGATCTT CATTTTTTCTGAATGTTGAGTTTTAAGCCAGCACTTTCACTCTCCTCTTT CAACTTGATCAAGAGGCTCTTTAGTTCCTCTTCAATTTCTGCCATAAGGG TGACATCATCTGGATATCTGAGGTTGTTTTCTCAACAATCTTGAAAAATA TTGGCAATATTTCTGGCAATCTTGATTCCAGCTTGTGCTTCATCCAGCCA GGCATTTCACATGATATACTCTGCATATAAGTTAAATAGGCATATAAGTT ATTTAACTAGGGTGAAAATATACAGCATTGTTGTGCTTCTTTCCCAATTC AGAAGCAGTCCATTGTTCCACATGTGGTTCTAACTATTGTTTCTTGACCT ATATACAAGTTTCTCAGGTGTCAGGTAAGGTGGTCTGGTATTCTTATCTC TTTTATTTTCCAAAGGTTTTTTTGATCCACACAGTCAAAGCCGTTAGTAT AGTCAATGAAGCAGAAATAGATGCTTTTCTGAAATTCTCTTGCTTTTTCA ATGAGACAACAGATGTTGGCAATTTGATCTTTGGTTTCTGCCTTTTCTAT TCCAGTTTTACATCAGGAAGTTCTTAGTTGACCTACTGTTGAAACCTAGC TTGAAGGATTTTGAGCATTATCTTGCTAACATGTGAAGTGATTGCAAATG TGCAATAGTTTGAGCATGCTTTGAAATGCCCTTCTTTGGGATAGGAATGG AAACTGATTTTTTTCAGTCCTGTGGCCACTATTGAGTTTCCCAAATTTGC TGGTATATCAAGTGAAGCACTTTAATAACATCATCTTTTAGGGCTTGAAA TAGCTCAGCTGGAATCTATCACCTCCACTAACTTTGTTTATAGGGATGTT TCCTAAGGCCCACTTGACGTCATATTCCAGGATGTCTGGGACTAGATGAC TGATCATACCATCATGGTTATCAGGGTAATTAAGATCTTTTTTGTACAGT TCTTCCGTGTATATTTGCCACCTATTCTTGATATCTTCTGCTTTCTTTAG GCCCATATTGTTTCTGTCCTTTATTGTGCCAATCTTTGCAAGAAATATTC CATTTGTATCTCTAATTTTCTCAAAGAGACCTCTAGTCTTTCTCGTTCTA TTGTTTTCCTCTATTTCTTTGCATTGCTTACTTTGGAAAACTTTCCTATC TCTCCTTGCTATTTTTTGGTATTCTGCATTCACATGGGTAGATCTTTCCT TTTCTCCTTTGCCTATAGTTTCTCTTCTTTTCTCAGTAATTTTAATCCCT CTTCAGACAACTACTTTGCCTTCTTGCATTTCTTTTTCTTGAGGATGGTT TTGGTCACCACCTCCTGTGCAATGTTACAAACTTCTGTCCACAGTTCTTC AGGTACTCTGTCTGCCAGATCTAGTCCCTTGAAACTATTCATCATCTCTA CTGTGTAATCATAAGGAATTTGATTTAGGTCATGCCTGAATGACCTAGTG ATTTTCCCTACTTTCTTCAATTTGAGCCAGAATTTTGCAATAAGGAGCTG ATGTTCTGAGCCACAGTCAGCTCCAGGTCTTGTTTTTGCTGAACAAGAAC TTCTTCACATTTGGTTGCAAAGAAGATAATCAATCTGATTTCTGTATTGA CCAACTGGTGATGTCCATGTGTAGAGTCATCTCTTGTGTTGTTGGAGTTT ATCCTGTTAATTAATTCTTAAACTATTGGTTCAGAAGTCTTTACCTTAGA AAATGTGAGAGCAGGTAAATAGGTAAAAGTATTGTCACAAAAACTTAGTA GTGAAATATTAAAACTCTGATATCAGATCAGATCAGATCAGTCACTCAGT CGTGTCCGATTCTGCAACCCCATGAGTCGCAGCATGCCAGGCCTCCCTGT CCATCACCAACTCCCAGAGTTCACTCAGACTCACATCCATCGAGTCAGTG ATGCCATCCAGCCATCTCATCCTCTGTCGTCCCCTTCTCCTCCTGCCCCC AATCCCTCCCAGCAGCAGAGTCTTTTCCAATGAGTCAACTCCTCGCATGA GGTGGCCAAAGTACTGGAGTTTCAGCTTCAGCATCATTCCTTCCAAAGAA ATCCCAGGGCTGATCTCCTTCAGAATGGACTGGTTGGATCTCCTTGCAGT CCAAGGGACTCTCAAGAGTCTTCTCCAACACCACAGTTCAAAAGTATCAA TTCTATAGGGTAATGTTATTAATAATAGCATCTTACTAATGGTAACAACA ACTGACATTTTTAGAATGATATCTGTACCTCAGGCACTCTTTTATATACT TTACATGGATTATCTCACTGATACTCATAAAGAGTCATGAGGTATCTACA GGTATCTTTATATTTAAAGAAAGAAAAATAAAGAAAGGGAGGGTTAAATA CAATAAGTAACTTTTCCAAAGTGCTGATGCAAAGAGGCAAATTCAAATAA TGGGACAATAAGACCCCTGTCTCCAAAATCACTGCAGCCATGAAATTGAA AGACCCTTACTCTTTGGAAAGAAAGTTATGACCAATCTAGACAGCATATT AAAAAGCAGAGACATTACTTTGCCAACAAAGGTCCGTCTAGTCAAGGCTA TGGTTTTTCCAGTAGTCAGGTATGGATGTGAGAGTTGGACTATAAAGAAA GATAAGCACTGAAGAACTTATGCTTTTGCACTTTGGTGTTGGAGAAGACT CTTGAGAGTCCCTTGGACTGCAAGGAGATCCAACCAGTCCATCCTAAAGG AGGTCAGTCTTGGGTGTTCATTGGAAGGGCTGATGTTGAAGCTGAAACTC CAATACTTTGGCCACCTGATGCAAAGAGCTGACTCATTGGAAAAGACCCT GATGCTGGGAAATACTGAGGGCAGGAGGAGAAGGGGATGACAAAGGATGA GATGGTTGGATGGTATCACCGACTCAATAGACATGAGTTTGAGTAAACTT TAGGAGTTGGTGAAGGACAGTGAGGCCTGGTGTGCTGCAGTTCATAGGGT CGGCAAAGAGTCAGACACGACTGAGCGACTGAACTGAACTGAACTGAAGT CCCATGTCTCAATAATATGTAGATTTAGACCCTGGATTTTACTGCAACTT AAAAGAATAAGAAAGCATGATATATATCATAACATACTTTAATATAAAAA TATTGACACTAAAATGTCATTGTTTGAACTAATGCAAAACTAGGAACATC AAAATGAAGTACGAATATTCTTTAGATCACCTCATACTTCTAAATGTAAC TTCTGATTTTGATTAGCTAACTTTCATAATGCAGATTTATTATCATCTTT TTGTCCTGGAGTAGCAAAAAATCATGTCAACCTCCATCTGAGAAAAGACA TTCAATTAGAATAACAGCATGCTCAGTTTTTCTTTTAATATTTCTTGTTT AATGATGGAACAAATTGCATTCTTCTTTAGCTCTTGTCTATTTGTTTCTG TGGCTATTTGGTCTCTGAATTCAAAGTTAATTAAAAATAGTTTAAAACAT TTTACCTAGGGAATATTTAGCAATTTAGATTTGATTGCTGTTAATATTCA AAACACCAGGCTTCCCTGGTGGCTCAGACGGTAAAGCGTCTGCCTACAAT GCGGGAGACCGGGGCTCAATCCCTGGGTCGGGAAGATCCCCTGGAGAAGG AAATGGCACCCCACTCCAGTACTCTTGCCTGGAAAATCCCATAGACTGAG AAGCCTGGTACTACAGTCGATGGGGTCGCAAAGAGTCGGACATGACTGAG CGACTTCACTTCACTTCAATATTTGAAATATGCAAGAATAATAACAGTGT TATGGGGTAGCACAATGATGTTCATTAATCATCAAGTGGTTGTTGATGAC CTCCTATGCTTCAGATGCTATGAAAGAAGGCCAACCTGGTTGGAACTTAG CTGTCAATGAGGGAGTGTGTGCAGGCTAAGCCACTTCAGTTATGTCTGAT TCTTTGCAAGCCCATGGACTGCAAACTGCCGGGTTCCTCTATCCATGGGA TTGTCCAGGCAAGAATGCTGGAGTGGCTTGCCACACCCTCCTCCAGGGGA TCTTCCCAACCCAGGGACTGAAACCATGTCTCTCTTGCCTGTCTCCTGCA CTGGGTTCTTTAGCACTAGCACCAGCTGGGAAGGACTTGTCAATGATGAA ATTATGCAAAATTGTTGGAAAAATGAAAATAAAGTATTAATAGATGTGCA TAGCCAAATCTGCACCATGGTTCGGTTTTATATTAAATGTCTGCCAAATA CATGGCACATAGATTCAAATTTGAGTATTAGGTAAATGGTAGATAGACAT AGTAAGAGAAATAGATATAGTCATACATATTTTAAAGCCTATAGTATACA GGTTATTATATACAAGTGTGTGGATACCAGTACCACTAGTCTTATATGTC TAATAGAATATTAAGTATATCTTCATTCAACCTGTATTTTTGTAAGATTT CCTATTACAGTGATAGTTAAATGGGACACTTCACATGTATCAGTGAATGT TTTTATGCTGATTTTTATGTAAAAGAAATAACCAGTGATCTATAGTGTCT CTCTCTAAACTACAGTTAAAATAATACATCCATCTCAAGTTAAACTTTCC TCCCACAATGGAGTACTGGGTGACTGATAATATGGCACATCCATTCAGGG TCACCAAGACAGCCATTGTTTCCCAGGTCAACATCATTCCTAAGGACACC ACATTGCTGCTGCTGCTAAGTTGCTTCAGTTGTGTCTGACTCTGTGCGAC CCCATAGACGGCAGCCCACCAGGCTCCCCCATCCCTGGGATTCTCCAGGC AAGAACACTAGAGTGGATTGCCATTTCCTTCTCCAATAAGGACACCACAT TAAGTGCTGTTAAATTCTGACAAAATTTTTATAAAAATGCAATAATACAG AAGCTCTTTATACAGAATAACCTGTATATGAACATCACTGGTGTCTAGAT TCTAGTAATGCCAACAACATTAAAGTGAATGTTGATGAAATTGTCTATCA GAAAGAAGATATGTGTTTGTTAAATATTCAACTTGTAAAGCATTAGTACA AGGATTTGCAAAGAACTAGTACACAATTTGAGAAATAAAAATTAAGATTA TCAAAAGAGTAAATAGAATACACCCCAATGTGGACCAAGTAAAATTTATG AATTCATGAGGGAGGAGTCAGGAATCAGAAACCACAGTATGGTTTAAAAT TTTTTTTAAAAAGCTGCTTTCTAAGGATTTTATTGTCTTAACATGTAATG ATTAGAGAGCCTTTAATGATCCAGCCAAGAAAAAGCAACTGTTTGGATGC TCCAGCTATACTGAGAGCATTAAACAATCCAAACCATGAGAATCATTTAC TTTGCTTGCTTGATTTGTGGATTAGATTGTGGAAAGTGACAGTTTTGGTG GTTCAGTCCTATTCAACTCTTTGG project fbnp AD 20040903 10920bp AACATCAGTTTGTGGAGTACATGACCAGAACATCACACTGCATGTAATAG TATAGTTAGTTTTAATTCGGTTGATGATCTAGTGGTCAGAGAAATATTTC TTTTGAAAGAGTATCCCGTTCTCCCTTGTCCACATTTTTCTTTTGTGTTA GAGAGCGTGGATGGTATGAACTCCCAAGAAAACCATGAATCAGAGCACTA AATCATGAGGAAGCGAAAACTGTTTTTTTTACAAGATATATATACATGGT TGCATGTTCATTTTCCCCAAATTTTTCCCCCCCTTTTGCCTTTTCCCCAA GAGTCCTTAAAGTTTTTTTAAACAATCATTTTTTTTTTTTTTTATTTTCT TACACAGGGTTTTTTTTTTTCCTTTTTTCTAAATTCCATATTTTTAACTC AACTACACTTCAGTAAAAAAGAAAAAAAAAATTCTAAGAATATTGATTAA TCAAACTCTTGAAACCAACAGAAAGTTGAAAAAAATAAGCATGAAAAGAA ACCTAACAAGAGATTAAAGTGTGGCAGTCAGGGAAAATTTTGGGTAGAAG ATGTCCATATATAATAAATTTCTAATATCTTAGTTCTTGATAGAGTTGTT TCCTGTATGGCGAATTCTACTGCTGGAACTCCTGAAGAAATTTGTTTTAG ATCTATCATCAGAATAGAAATATGGGAGATGATGTATGTCTTTTTAACCT AGATGCAAAAATTCACTGGACTCTTGCTGACATGTTTGTGGTTAACTGTA ATGGCTCTTTAGTGGGGCTCAAAGGCACTCTTACATTGCTCTTGTTTCCA GTAAACTGGATATCTAGGCTGAAGGTTATGAAATTATTCTTAAATTTTAT CCTGGGGAAGGTCATTAAACCTGTTGATGATAAACTTGGACATGAAGTAT TAGACCTCTACATTGTTTTGCCATATCAGCCTATAAAATAGCAGGTTCAA GGTTAGGGGTGAGGTTTTCAGAGGCCCCATGTATCCAGTAATGAGCTCCT ATGGGGATGGGCTAGTTACTGTGGAGTGGACAAATAGAGTTGGAGATACT AGCAGTGTTCTTCTAGGAATGCAAGCTCAAAAATGAACAGTGCATTTGAA AAGTACTTTAAAACTAATTAATGGCTTAATCATGCTAACCTTCCTGTAAA ATTCTCATTAATACTTGAAGTTCAAATCATAGTATTGAACTTTGCTTTTG TTTTTGTATTTTTGTTAACAGATTTATATAATAGTGTCAGGCGAGTGTAT GTTTCTTGGTTCTTGTCTTATCACAACAACGGTTTGGAGTGATGGACATT AAAGCCCGCAGCACGTCACAGCTCTCAGGTCTTGAACAAACCATTTCATA GCTCTTAGACAAATCAGTGTTACAGCTCTATTTTATTAAAAATATAGCAG GAGAATCCATCCTCGAAGAAGAGAAGAGAGTGGAGGAGCATGCCAACATG CGTGGGGCGGCGGGGGCGGGGGTGTGGAGTCGGGGGGGTGGAGGGGAGAG AGAGAGAAAGAGCGTATGCATGAGAGAGAGAGAGAGCGAGAGAGCACTTT GCTCCTCCTTTTATGTTTTCTTCCCCCTGGGCCTGCCCTATGCAAATTGG GCTCATCCAGGAGTGCTGTTCTACCTGAAGTCCTCACTCAGGTCCTCACT CTGGTCCTTGGACCTTTATTTGACCTTTCTTTGTTCTATTTTTGTGGGCT TTTCCCTTCCTTGTCTTTTAGCCACCACCATTTTGGACAGCTTTTCCCTA TTCTACCTACCTAACAATAGGATTATATGTGCTGGTTAAAGACCTCCTGT AAACACATGTTTATGGAACTGAATCATATCTGTTTTCAAAGATTTCAAAT ATAGAAACTAAAACTACACATATTGCACATAATGAATGGCAAATTAATTA TTATAGTATGGATTATAAACTGAAATTCTTCTAGTAGATGAAATCCTGAG CTATGAAAAAAAAAAAAAAGAAGTGAAAGTGTTACTCACTCAGTCATGTC CAACTCTTTGAGACTCCATGGAATTCTCCAGGAAAGAACAAGGGTAGCTA TTCCCTTCTTCAGGGCATCTTCTTGACCCAGGGATCAAACTCGTGTCTCC TGCATTGCAGGCAAATTCTTTACTATCTGCCCCATCAGGGAAGCCCAGTC CTAAGCTCTGGCCAGAACTAAAGCCTGACATCAAGAAGCTAAGCCTTCTC AAAATACTCATCTTCTCCAGGGTAGTCACACCCCCAGAGAGAAAAAGCAG AAGATGGTGTAATTAACAGTCTTTTATTACCAAGCCAAGAGACCAAAACA ACAACAACAACAGCAACATATGACTAACTACCATTATATTGAGGACTCCT TTCCAAAATCTAAATCTTGATAAGAAAAACATAAGTCACTGTAACTGTGA CATTGTTGATATCACGGTAAATGGGGGAGATGTTTTATATCACTGAACTC TAACAATAGTTGACCATATTCATTTGGGAAGAGGAAAGTCTCTAATGGTT TGCATATTCATTATTTTTTCCTAATACACTCAACACTGAAGGACTGGATG TTGATCTTTAAAAGATACTGTTGATGCCAGATTATTTTATATAATTTGAG AGCACAGGCATTGCAATCTGCCCTTCATGATCCCATTAACTGTACAGTAT ATGATTTGGTTCTTTAATTTGATTCTGAAACACTTTCACATGCTTGTGAA ATTCCGGAATTCTCCAGTTCTCTCATGAATTGGGTTTGCGTTTGACAAGG GTTGTAATGTTTTGGACTTCCCAGTTGGCTAAGTGGTAAAAATCTGCCTG GCAATATAGCAGAAACAGGAGACCTTGGTTCGATCCATGGGTAGGGAAGA TCCCCTGGAGGAGGAAATGGCAACCTGCTCCAGTGGTCTTACTTATAAAA TACCATGGACAGAGAAGCTTGGTGAACTATAGTCCATAATGTTGCAAAAA GTCTGACACAGTGGACAGACTGAGCATATGCACTGTAATGTTAGAACAGT TAAACTGTCTTCCATGTAAGCCATTTGTCATTTTTTGGAAATCTTAGATA ATGTTTTTTTTTTTTTTTTTGGATAAAACTTCTAATCCTCTTTCCATGGT TAATATAATTTAAAAAGAAAATCATATTTAAATACCACATTTCTAAATTG CATATGCTTAATTTAGTTGCTTTTAGTTTCAGTATTTATTATTTTCAAAT AACTTCTTACATTTTTTCTAACTCCTTTATTTTTTAATAAATAAAGTTAT ATTAATTTCAAATAAACTTTTACTTTCTGCTGTATGAAAATATTATAAAA ATAAGCTAATAGGAAAAATAATTAGATTAGATTACCAATTGTCAATTTTT GCAGCGTTTTTATTTTTGCATCTGTCTTTGTGTGTGTGTGTGTATGTGTG TTTGGTGTATAATTCTGTAGCATACAATAAAAATGACTTTATTATACAAA ACCTAAAGCAACTATTTGTTGGCATCCATGCCTTGAGAAATGTGGGAAAG GTGTCTACCCATCATATAAAAGCTGTTTAGATTTTAAGCAAAATTAAATT TTACCTTTGACGATTTTTTAACATGGAGATATAAAAAATGTCCTCTAAGT GTTCACTTATATGTGCTAAATTTTAAACTTTATATCCCTGATGAACCATG CATGTCATACTTTTAGCTTTCAAAATTGAATTAAACCCCATATCATAAGA AAATTTCTATGACATATTGTTCACAGCTTTCTTTCTCTTTATCTTTAGCT CCTAAAACACAAGGGTTTTAATGTTTACTTTTTTCACTAACAATTAATCT TGATGGAATTCATTATTTGTTTTTTGTTTCTTGATAAATCAACAGTGGAT GAGTGATGAAATCTCAGTAAATATTTATTCAATAAGTGGAAGAATAAATG AATGAAAAAAAAAACTGAAACCTTTGCACGAACTATGGTCATCATCTTTC TTTGTTTACAGGTTAACCTGTAGGCTACTAAAAACAGCCAGTGTTTTTAT ATCAGAGTAGACTCCAAATTATTTTCCGTTGAACAGTTTTGACTAATGGT TACATATTTTGTGTATCACTTGGGTAATCCACATGCTATATATGTCACTC CTTTGAAAATTTAGGCATGTCTTTATAACTAGACAATGCCATTAATTTCT GTTTACTTCTGAAAAATATTTTGTTTTGTCTTTTAACCACACTGCTAATT AATTTTGAATTTGCACATGTGTTTTTAGATCTGCCTTTGTTTCACTGGTC AGATTTTTATCTTTATGGCAATCACATTTTTGATAAGTTCATAAATCTGA ACCTTTTTAAATGTGGAAGAGTGCATATCAAGGAGAAAAGATTTTATACA ATACACATGATCAATATAAAAATTCTCCATTTATCTTTGATATTTCTTAT TTCATTTCATATTTTATAAAGTATCAAAGATGAAAATGAAATTGTCTTCT TTGTTAAAGTGTAGTACATGAATATTGCAAAATATGTTACACACAAACAC ACCTTTATTCTGTAATTTGGGGACTTTTTACAATTATTCTGTGATTCAAT AAATAAAAATAAACCCATGCCATATATATATATATATATATATATATATA TATATATATATTTTTTTTTTTTTTTTTATTTCATCAGGACAGCTTTTGAG ACTTAGGAAACTAATACTGTTTATGTATTTAGATTTTTCTTTCATACAAT GTTGTGTTATTCACTCAGCTGTGTCTAACTCTTTGCAACCTCGTGGACCA TAGTTTGCCAGTCTCCCCTTTCCATGGAATTCTCCAAGCAAGAATACTGG AGTGGGTTGCCAATCCGTTCTCCATGGATCTTTCTAACCCAGGGATAGAA TTCTTAAATATATAAGCTTTCATCAAAAGGATATGTCAACATGCTTTTGA GAAATGTTTTACTATCAAATATTTGAAATATTAATTTACAAAATTTAACT GAATCAACAATTCTGCTTTTTTTCACTAATTATATGAGCAGGGAAAAGCT AATAGAGTTTTTGCCAAGAGAAGACACATTATAGCAAACAGCCTCTAACA ACAGCACAAGAGAAGACTCTACACATGGACATTACCAGATGGTCAACACC GAAATTAGATTGATTATATTCTTTGCAGCCAAAGATGGAGAAGCTCTATA CAGTCAACAAAACAAGACTGGGAGCTGACTGTGGCTCAGACCATGAACTC CTTATTGCCAAATTCAGACTTAAATTGAAGAAATTAGGGAAAACAACTAG ACCATCCAGGGATGACATAAATCAAATTCTTTACAATTATACAGTGGAAG TGACAAATAGATCTGATAGACACAGTGCCTGAAGAATTATGGGTGGAGGT TCATGACATTGGACAGAAGGCAGGCATTAAGACCACCCCCAAGGATAGAA ATGCAAAAAAACAAAATGGTTGTCTGAGGAGGGCTTACAAATATCTGTGA AAAGAACAGAAGCTAAAGGCAGAGGAGGAAAGGAGAGATATACCCATTTG AATGCAGAGTTTCAAAGAATAGCAAGGGGAGATAAGAAAGCCTTCCTCAG TGATCAGTGCAAAGAGATAGAGGAAAATAATAGAATGGGAAAGACTAGAG ATCTCTTCAAGAAAATTAGAGATACCAAGGGAATATTTTACACAAAGATG GGCACAATAAAGGACAGAAATGGTATGGACCTAACAGAAGCAAAAGATAC TGAGAAGATGTGGCAAGAATAAACAGAAGAACTATACAAAAAACATCTTC ACAACCCAGATAATCACGATGGTGTGATCATTCACCAAGAGCCAGACATC CTGGAATATGAAGTCAACTGGGCCTTAGGAAACATCTTTATGAACAAAGC TAGTGGAGGTGATGGAATTCCAGTTGAGCTATTTCAAATCCTAAAAGATG ATGTTGTGAAAGTGCTGCATTCCACATGCCAACAAATTTGGAAAACTCAG CACTGGCCACAGGACTGCAAAAAGCCAGTTTTCATTCCAATCCCAAAGAA AGACAATGCCAAAGAATGTTCAAACTACTGCACAATTGCACTCATCTCAC ATGCTAGTAAAGCAATGCTCAAAACTCTCCAAAGCAGGCTTCAGCAATAC GTGAACTGTGAACTTCCAGATGTTCAAGCTGGGTTTATAAAAAGCAGAGG AACCAGATATCAAATTGCCAACATCTGTCGGATCATTGAAAAAGCAAGAG AGTTCCAGAAAAACATCTACTTCTGCTTTACTGACTATGCCAAAACCTTT GAATATGTGGACCCCAAGAAACTCTGGAAAAGTCTTAAAGAGATGGGAAT ATCAGGCCACCTGACCTGCTTCTTGAGATATCTGTATGCAGGTCAAGAAG CAACAGTTAGAACTAGACATGGAACAACAGACTGGTTCCAAATAGGAAAA GTGGTACGTCAAGGCTGTATATTGTCACCGTGATTATTTACCTAATAGGC AGAGTACATTATGAGAAACACTGAGCTGGATGGAGCACAAGATGGAGTCA AGATTGCTGGGAGAAATATTAACTTAGATATGCAGATAACACGACCCTTA TAGCAGATAGCAAAGAAGAACTAAAGAGCCTCTTGATGAAAGTGAAAGAG GAGAGTTAAAATATTGGCTTAAAACTCAAAATTCAGAAACCTAAGATCAT GGCATCTGATCTCATTACTTCATGGTCAGTAGATGGGGAAACAGTGGAAA CAGTGACAGACTTTATTTTTTGTGGGGGCTCCAAAACCACTGGAGAAGGC AATGGCAACCCACTCCAGTACTCTTGCCTGGAAAATCCCATGGACCGAGG AGCCTGGTAGGCTGCAGTCCATGGGGTCGCTAGGAGTCGGACACGACTGA GCGACTTCACTTTCACTTTCATGCATTGGAGAAGGAAATGGCAACCCACT CCAGTGTTCTTGCCTGGAGAATCCCAGGGATGGAGGAGCCTGGTGGGCTG CTATCTATGGGGTCCCACAGAGTCGGACACGACTGAAGTGACTTAGCAGC AGCAGCAGCAAAACCACTTTAGACGGTGACTGCAGCCATGAAATTAAAAG ACACTTGCTCATTGGAAGAAAAGTTATGACCAACCTCAATAGCACATTAA AAAGCAGAGACATTACTTTGTCAGCAAAGGTCCATCTAGCCAAAGCTATG GTTTTCCAGTAGTCATGCATGGATGAAAGAAATGGACTATAAAGAAAGCT GAGCACTGAAGAATTGATCCTTTTGAACTGTGGTGTTGGAGAAAACTCTT GAGACTCCCTTGGACTGCAAGGAAATCAAACCAGTCAATCTTAAGGAGAT CAGTCCTGAATATTCTTTGGAAACACTGATGCTGAAGCTGAAACTCCAAT ACTTTGGCCACCTGATGGGAAGAACCAACTCACAGGAAAAGACCCTGATG CTGAGAAAGACTGAAGGTGGGAGGAGAAGGGACGACAGAGGATGAGATGG TTGGATGGCATCACTGACTAGATGGACGTGAGTTTGAGTAAACTCGTGGA ATTGGTAATGGACAGGGAGGCCTAGCGTGCTGCAGTCCGTAGGGTCGCAA AGAGTCGGACACAACTGAGCAACTGAACTGAACTGATGAGCAATGTTTTT TTCATGTTTTGATAGATAGTTAGATAACATTACAGATGGATACATAGTTA GCTTTGACACGTTGGGGCTTCCCTGATAGCTCAATTGGTAAAAATTTGCC CTCAATGCAGGAGACCCCGATTTGATTCCTGGGTGGAAAAGATCCACTGG AGCAAGGATAGGCTACCCACTCCAGTGTTCTTGAGTTTCCCTTGTGGCTC AGCTGGTAAAGAATGCATCTGCATGCAAGAGACCTGGGTTCGATCCCCAG GTAGAGAAGATCCTTTGGAAAGGGGAAAGGCTATGCACTCTAGTATTCTG GCCTGGAGAATTCCATAGTGCATGGTGTTGCAAAGAATCAGACGTGACTG AGTGACCTTTACCTGATACTTTTACATGCAGAGAAGTAGTGAATTCCCAA TCAATAATATTGTCATTACATACATACTCTAGAATTGCATCCTTTAAGTT CTAAAACCATTTCTAAAACTATTTTATTTTACTACCCCTCTATTTGTCAG GTTTTAGTGAAGTTTAATTTTTTGATAATGCACTAAATCTATTTTTCAGC AGAAAACAACATACCTGATTGGAAAGAATAGAAAGTCACTCAGAAATTAG CGAAGCTCATTTAAACAGAACTCTTCTGAAAACTACTATTCAGGGACTGA ATGGTCTGAGACACAATACAGATTTAGAATAATCCAAAGATCATTTTTTA AAGGAATACAAATAGAAATTTCTGCTTAGCTTGAGAATATACCCAGGTGT TCCAAAGTGTAACATTAACATGAATTCAAATTTCCTAAGTTATGGGAAAC TTTGTATGTTCTTTTCATCTTTAACTAAAAGCAAATAAGACCTGCATGTT TCATGTTTCAGATCTTGGCTTGTGGTGAATTTCTGCATTATTTCAGGTTG GAATTCTACTATTTAGGTAGATAGAACTTCTCCCCATGGGAATTAAACAC ATATCTTAAAAACTTCAGTATGAAGCACTTGTTTTGTCAAGAAGGTGAAT CTGAGGTTGTATACTATACTTTGCTCTGAAGAGTCAAGCATCTCAGCAGT CATACTTGGGTTTCCTGCTGACATTATGAATGTGTACGAAGCCAATTTCC ATGCAGAAAAATAGCTCCAGGACTGACATGGTACCCATAATATAAGAACC TAGTGTTTAGTGAACTGCTCAAAAAACAAAAACAAAAACAAAAACAAACA AACAAAAAAACCACTTCTCCTTCTGTCACTGCTTCTCTAAGAATGAAAGA GAATGGAAATTGAATGCAACTTAGTTAATATGGATCAATTCAATTCCAAA ATATACAATTTTGTACATACTTCACTTGAATGCATCTGCATACCTTCTAG AAAATTTAAGGAGTATTTTAATGGTGAGATAGCAGTATTCTTTATGAAAA CGTATAAGTATAATCATTTGCTCCAGAACTGAGCTCAGAATAAAGGACGG CATAAATAATACAGGAGTTTCTGGGAGCACTGAAACACAGATTTTCTAAG TATGTCTATGTTTGTGTTGGCACCTGTTTACCAAGTCATGGGTTTTGTTA CAGTTGCTTTATTGACATCTTCCTAGAATAAGAGAATAGATATTTTTTCA AAAGGAAATTAAAAACCATGGAATATGCATTTGAAGGTGGCTCACTGAAT GAGTTTTACATCTTCACAAATAATATCATCTTAAAATGAAGGATGACCCA TTTTCTAACTTTTCAGAGGGTATTTAGGGGGAATAATTGAACTGCATGAC GAAGCAACTCATTTCCTTGCATAAAATATCCTTGAATATCCTTGAATAAA AAAAATGCCAAGAGATAGTAAAAGTCTTTTGACAGAAATATATATATATA TATATATATATATATATACATTGTTATAATTATTGATTAAAATACAGTAT TTATAAATTTCGGGCTAATTTATAAATATACATCCTTATTACCTGTGGAG CTTCCCAGGTGGTTCTAGTGGTAAAGAACCTGCCTGCCAATGCAGGAGAC ATAAGAGACACATGTTGATACCTGTGTCAGGAAGATCCCCTGCACGAGGG CACGATAACACACTTCAGTATTCTTGCCTGAAGAAGCCCATGGACAAAGG GGCCTGGCAGTTTGAAGTCCATAGGATCACACAGGGTGGGACACGACTAA AGCACACAGCACAGAGCACATATTACCCTGTGACCCTAATTTGAGTTAAA ATCTTACTCTGATTCCAACAGTAGATGGTGGCGGGTATACACCAGATCAA TCTGAGAAAGCATTAGAAGAGGCCACTCAGATAATCAATGAGGAAAAAAA ATACATATTAGACTTCAAGTCCTTTTTTAAAAAGATACAGATAGAATACA AAATTTAATCCATATATTTCTTTTGATATTGGTTGATAATGGGTGTTCTG TCACAGCAAATATTGATCACTAGAACTATATCTATATCTATATATCTATA TCTATCTATCTATCTACCTATCTATATATATATATATCTCAAAACTCAAA AGATCTCTGGACTATTGTGTTTGAGAATACTTTTCAGGCTTATGTTTTCC TTCAAAGATTCTAGTTTCTGAATTCTCACAGACATTAAATATGGTGTATC TTATGAAAAACTGAGAAATTTGAAATCGTATAAATTTATATGCAGCAAGA ACAGATACAAAAGAGACATGGATGAAGGATGAACCTTGAGACACTGAATT TTAGTATCCAGAATGTAAAGTGAATCAACCAATAAAGTAACTTGATGTGA CCAGATATGCAAGTGGAAAAATAAGTGAATTTTGTATTTGAAGATCAAAT GATTAAATTGACTCAAGGGGAAAAAAAAAAGAAGAAACCAGAAGTGTCAA ATTCTGCCCATGGGCAAACTTAACCCCAGGATTTACCACCAAAAGATTCT CATTACCCCCTTCTTACTTTCCTGGATTATACATTACATCTGGTTGTAAA CAAACTACTTTAAAAAATAAATCTGCAATGAAGATTTAAACAGGCAATTA TTAAGGATTATCTCCTAAAAAAACCCTATTGAAAAATAATTAAAAAAGGG AATCAGGGAAAGGGAAAAAAAATGGAAAGGGTGGGTTTCGTGGGAAAAAG GGTCCTTAAAAATCCTTTCGGAAAACCCCGAAATTGTGGAAACCCCCCTC AAGAAAATATTTGTAATTTTAATATTTTAGGGGGCCCAAAAAAATACCCT CGGGGGGGGAAATAAATTTTCTCCTTTTTAACACAGAGAAAAAAAATTTT CGGGGCCCCCGCCCACCCCCTTTTTTTGAGAAGAGGGTGTGCTCCTCTCC CCCCCCCCACAACTCTCTCC project fbnp AE 20040903 10056bp GGACGATCAGCAGAGTTCTCCCCTAGGATAAGCTCTCATTTATGGTTTAT TTTGCTTTCTATCCATAATGAAAACAGTACATCTATCTTCTTCAAACTTT ATTGCCACTGCTTTTTTTAAATGTTGCTGTTCATCAGAGGGGAATATTTT TCCATCTGTAATTATTGAATGGACTCAGGAGACTACTTTCAAGAAGAGGG GACCTTCTCAAACCTCAAAGTGCATTTGAATAATCAGGGTACCTTAGTAA AATGCACATTCCAAATCATTAATTTTGAATTAGGGTCTGAAATCCTGCAT ATCTGACAAGCTAAGTAAACTGAGTACAGATTTACTCTTAGTAACCAAAA TCAACAGTATATTGAACTATATTAGTAAAATGGGAAATGTTATGGCAAAC AAAATGATTTATGTGTTGCTGCTGCTGCTGAGTCGCTTCAGTCGTGTCCG ACTCTGTGCGACCCCATAGATGGCAGCCCACCAGGCTCCCCTGTCCCTGG GATTCTCTAGGCAAGAACACTGGAATGGGTTGCCATTTCCTTCTCCAACG CACAAAAGTGAAGTTGCTCAGTCATGTCCGACTTTTCTCGAACCCATCGA CTGCAGCCTACCAGGCTCCTCCGTCGATGGGAGTTTCCAGGCAAGAGTAC TGGAATGGGTCGCCAGTGCCTTTTCCGATTTATGTGGTAAGTTACCCTAA TTATTCAAAATTTGCGTTGCAGTCAGATTCTTTAGTAGGTGAGCCACCAG GGAAGCCCAAGAGTACTAGAGTCGGTAGCCTATACCTTCTCTAGCAGATC TTCCTGACTCAGTAATTGACCGGGGTCTCCTGAATTGCAGGTGGATTCTT TACCAGTTGAGCTGCCAGGGAATCCCTGTAAAATTGGAAATGTTATGGTA AAAAAAAAAAAAAAAAAAAAAAAGATCTATGTGGTCAAGAAGCCTGGAAA CATTCAAATACACAAAATTTTCAAAAAAAAAGTCTCCTATTAGTAGAATA TTCATATTATCAGGATTAATCCATAATAGATATGGAAGAGGAAATATCCC AAATCAAGAAATATCAATAATATTAATAACCTATAATATGTCCTTAGAGC TTATAGTTAAGAAAATATGTTAAAAAAGAAAAAATATCACACAGAACAAG ATGAGTAAACAAAAGTTGATTTTATTCTGATCCTATTGCCAGCAGCTGGG GAGACAGCACAGATCAAGCCTGCATACCCAGCTCCATGGAAAGAAAAGGC AACAAGATTTTAAATACTGGAGTGAGCTAGCGGAAAGTTACTGAGGGCTA CTGAGTGGGAGCTTGATACATTGGGTATGTCTACCACATTAAAGTGGTTC CCAAGTTTGCAAATGTTTTCCTCTGTAGGCCATTTGTGTTTGATAATGAG CTTTTCCCCAAGAAAAGAAAAAATTTCCCCCTGTCTTCATCACTAAAAGT AGTTTTGCAACTTGAAGCAAGGGCTCCAGGGTTAAACTGAATTTAGCCTC CTACACCCCTGTAAAGATCGACACATAGGGAACTGGCTCCTTCCTTGATT ACTTTAAAAAGGGAAGGGCTCTCACCCTTTTATGAGAAAAAACAGGGGTT GTTGCTATTGTTCAGTTGCTAAGTTGTGCCCAACTCTTTGTGACTCCACA GACTGTGACACCTCAGGCTTTTCTGTCCTCCTCAGGCTTCACTGAAGGCT TAGTGGTAAAGAATCCACCTGCCAATGCACAAGATGGTGGTTCAATCCCT GGGTTGGGAAGATCCCCTGGAGAAGGAAATGGTAATTCACCCCAGTATTC TTACCTGGAAAATTCCATGGACAGAGGAGGCTGATGGTAGGCGGTCTATG AGGTTGCAAAAAGAGAAAGATAGTCCTGAGTTACAAAATTGGAAAGAGCC TTTTAAAAAGATATTTATCTAAAAGGGACAAAGAAATAAATTAAAATTAT ACATTTTAATGCTCTAAGAAAAGAAATAGATCAGATGATTCAGGAAAAAG TCATGAAATACCCATCAAGTAAATACCTAAATATATGTTAGAAGTCATTG AAAGTGTCTACTTGAAATAGAAAGTTTTGTTTTGATAAAAGTTGTTTAAA ATTTCAGTTTAATCTACAAGAAGCAAACATATCCATCATTCTGGCCTTCT TGAAATTTTGCTAAATGTATGACTGTTCATATTATACAATATTCAGTTCA CTTCAGTTGCTCAGTCGTGTCAGACTCTTTGCGACCCCATGAATCGCAGC ATGCCAGGCCTCCCTGTCCATTACCAACTTCTGGAGTTCACTCAAACTCA CGTCCATCGAGTTGGTGATGCCATCCAGGCATCTCATCCTCAGTCGTCCC CTTCTCCTCCTGCCCCCAAATCCCTCCCAGCATCAGAGTCTTTTCCAATG AGTCAACTCTTCACATGAGGTGGCCAAAGTACTGGAGTTTCAGCTTTAGC ATCATTCCTTCCAAAGAACACCCAGGACTGATCTCCTATAGCATGGACTG GTTGGATCTCCAGTCCAAAAGTTATGTGCTATATTTTGTTATTTTGACAA GGAGATTCTTATACATACAGAAAGCTAGCATCATTGACCCAGTGGTTTAT TGATTGTATTGTTTCATATTGTATTGTTCAAGGGAAATTTTGTTTGTAGA TCCTAAGAACATTACCCATTCATCTGATTAGTGTCATACAGATTGCAGAC CTTATATTTAGCAAGAAGAAAACAGCTTTTATGAAGATTAGCTATCCAGT TTGAAATCTTGATAAAGTGTGGAGAGGAATCTCACTGAAGTCACTTAAAA AAAAAAATCCTATGAGTCTAAACCAAAAGCAGAAGCACCATTCCATACAG AAAGCTGTCTGAGATTGACAGTAGTGAGGTTTCCCAGAAAAAGTAAAGCC TTTGTCTGGCTGCCAGAAACAGGCCTGATTCATGTTCAAGGAAATATTCT TTCTAATCTGAAGAATATTGAGATATATATCTGAGAATATTTCAAATTCA GTGGATCAGTGAATTAAAGCTATCTCTGATGTACACCCTCAAATGTACAC AGAGAATGCCATTCCCTGTAACAGCAAAGATCCATATATGTGTTAATATC TAGAGTTCTAATATGTAGCAGAATGCATGTACAAGCCTCTACCTTCTAAA ATGTAATTTTTAAATCATCTGATTTTGAAAACAAATAACTAAACATCAGT GTAACCTCTAATTCAATCTATGACATAAAAGTAAGACGCATAAAATTTTA ACACAGAGATCTCAGAAAATCATCCTCAGATGCCCTAAGAAAATTACAGA ATTTTACAGGGAAAAATCATGAGGTCCTAGGATAGACAACCTTCATTTCA TGTGTTAAAATCAAGGTCAGGAAAGGATGAACAGTTAGGGAGTGGCTATG AATAAAACTCAAGCATGTGGTAGCTCAGCTGATAAAGACTCCACCTGCAA TGCAGGAGACCCCACATTCAATTCCTGGGTCAGGAAGATCTACTGTAGAA AGGATAAGCTACCCACTCCAGTATTCTTGGGCTTCTCGGGTGGCTCAGCT GGTAAAGAATCCGCCTACAATGAGGGAGACCTGTGTTTGATCCCTGGGTT GGGAAGAGCCTCTGGAGAAGGGAAAGACCACCCACTCCAGTATTCTGGCC TGGAGAATTCCATGGACTGTGTAGTCCATGGGATCCCAAAAGAGTGGACA AGACTGAGTGACTTTCACTTTCATGTTTAAAACAACAACAACAACAACAC TGGCATGCTGTTTCTTTTTTTTTTTTCAACTGTCATTACAATATTTGTTT AAAAAGGTTTTATTAGCTTGAAATTCACTCATTATTTTCACAACCTCTTG CAGAGGTTAAGAAAAGCAAATTTGAGATCTATTAACTTGGCTAATCCTCT CATTTATATGTACTCTAATACCTTGTTTAACCTTTCTAGCTATGCCACAT GATTATTTAACTGGGAAAAATGCTGGCTACCTTATGGTTTCATTGTGGAT ATTAAATGTAATAGTGTATATGAAACAATTAGCATGCTTCCTGTGCCAAA CAAATATTAGCTACTCTGTAATTATCATTATCATAAGATATTCAAACTGA TTTAACCAATATTATTATCATACATTATCTGATTCAGCAGCTCATGTACC TGCTCACATACAATTACTTCTGTACATATTCTAAGTGAAGAGTCAGCAAA TGCAGTGAAGGGTTGGCAAGTTAATGACATTTCAATGATCCAAAGAACAA CAGAAAACAAACAAAACTTTTCAGTTAAGAAAAATGTTTTTCTATTTTCT CTGTTATAAACAGTTCTACACCTAGCTTATGGAATGGCCACACTATTTTC CTTTGCTGATAAATATGACCTTTGTCCCTCTACTGGTGAAGAGCCACAGA TTTTCCTTCTCTAATTCTATATTTACTCAACTTTTCTAGAGAGAGTCCAT CTACATTTTTTCCTGAACTTCTATAAGTTTTGTCACTAAAAGATTGTTGC GGATACATTTTCTATCACAAAAAGTGCTAGTTTTTCATTTGTAAGCTAAA GAACAGAAAAAAAAAATTGTAGAATATTTTCCCTCCTTGATTATTATTCA GTTTTACTTTTATTTGAACTCAAATAAATTCACAATAATATATTAATGAC ATATTTTAAATTTATACTGAAAATGGCAGTATTTTGTTGTTTAGTCTCAA AGTCATTTCTGACTCTTTTGTGATGCCATGGACTGTAGAATGTTGAGTTC CTCTGTCCATGGCATTTCCCAGGCAAGAATACTGGAGTGGGTTATCATTT CCTTCTACAGGAATTGTCCTGACCCAGGGATCGAACCCACATCTCCTGCA CTGGCAGGCGGATTCTTCATTACCGAGCCACCAGGAAGACACAAATGGCA ATATTAATTGGTATCATTCAAAGGTAGCTTATTTAAATTTATAAACGGCT ATCAGAAATCAAGTTTTGCTTGTCTTGATTTGAGTTGCAACATTTTACTG ACTTGACAAGATAAGTGAACTCTACTTATATAAGAGATTGATGTACATGC TTGTTTGAACTTAACTGAAGATTAATGTTCCAAATCAAGCCTTCCTTCTT CTTTAAAGAAAATGTATTAAAAATTAAATATAATTCACTGAAACTTCCAT TCACTTTATATGTTTACTTTTTCTCTGATGTTGAAATGAATTATTTTCAT TGTTTGAGGTTCAGAGCATCTTCTATGCCACTGGAATATAATCTACTGAC TATAATATAAAGATCTCACTGGGGCAGCAGTCCCAATATGGAAGAGGAAT AGGACAGGGAGACCACTTTCTCCCCCCAAAATTCATCAAAAGATCATTTG AATACTGAGCTACTTCCACAAAACCACTTCTGAACGCTGGTGGAGGACAC TGGACACCAAGAAAGGCAACCAATTCTCTTCAAAAGGAGGTAGGACAAAA TATAAAAGACAAAAAGAAAGACAAAAATTTAGGGATGAAGACCTGTCCTG GGGAGGGAGACATGATGTAGGAGAAGTTTCCAAACAGTAGGAAATGGTCT CACAGACAGGTCTGTGGGGATTTTTGGAATCTCAGAGGGCAACATAGTCA GATTCAGTCACTCAGTCGTGTCCAACTCTTTGTGACCACATGGACTGAAG CAGGCCAGGCCTCCCTGTCCAACACAAAATCTGGGGTTTACGCAAACTCA TGTCCATTGAGTCGGTGAAACCTTCTAACCATCTCATCCTCTGTCATCCC CTTCTCTTCCTTCCTTCAATCTTTTCCAACATCCTGGTCTTTTCAAATGA ATAATCACTTCACATCAGGTGGCCCAAATACTGGAGTTTTTGCTTCAACA TCAGTCCTTCCTATGAACACCCAAGACTGATTTCCTTTGGGTTGGACTGG TTGGATCTCCTTGCAGTCCAAGGGACTCTCAAGAGTCTTCTCCAACATCA CAGTTCAAAAGCATCAAATCTTCTGTGCTCAGCTTTCTTTATAGTCCAAC TCTCATATCCATACATGACTAATGGAAAAACCATAGCCTTGACTAGATGG ACCTTTGTTGGCAAAGTAATGTCTCTGCTTTATAATATGCTAAGTTGGTC ATAACTTTCCTTCCAAGGAGTAAGTGTCTTTTAATTTCATAGCAGCAATC ACTATCTGCAGTGATTTTGGAACCCCCCAAAATAAAGTCAGACACTGTTT GCACTGTTTGCCCATCTATTTGCCATGAAGTAATGGAACCATATGCCATG ATCTTAGTTTTCCGAATGTTGAGCTTTAAGCCAACTTTTTCACTCTCCAC TTTCACTTTCATCAGGAGGCTCTTTAGTTCTTCTTCAGTTTCTGCCATAG GGTGGTGTTATCTGCATATCTGAGGTTATTGATATTTCTCCTGACAATCT TGATTCCAGCTTATGCTTCCTCCAGCCCAGCGTTTCTCATGATGTACTCT GCATATAAGTTAAATAAGCAGGATGAAAATATACAGCCTTGAACTACTCC TTTTCCTATTAGGAACCAGTCTGTTGTTCCATATCCAGTTCTAACTGTTG CTTCCTGACCTGCATATAGGTTTCTCAAGAGGCAGGTCAGGTGGTCGGGT ATTCCCATCTCTTTCAGAATTTTCCACAGTTTTTGTTATCCACACAGTCA AGGCTTTGGCATAGTCAATAAAGCAGAAATAGATGTTTTTCTGGAACTCT GTTGATTTTTAAATGTTCCAGTGAATATTGGCAATTTGATCTCTGGTTCC TCTGCCTTTTCTAAAACCAGCTTGAACATCTAGCTGTTCATGGTTCACGT ATTGCTGAAGCCTGGATTGCAGAATTTTGAGCATTACTTTATTAGCATGT GACATGAGTGCAATTGTGCAATATTTTGAGCATTCTTTGGCATTGCCTTC CTTAGGGATTGGAATGAAAACTGACCTTTTCCAGTCCTGTGGCCACTGCT GAGTTTTCAAGTTTGCTAGCATATTGAGTGCAGAATTTTCACAGCATAAT CTTTTAGGATTTGAAATAGCTCAACTGGAATTCCATCACCTCCACTAGCT TTGTTCATAGTGATACTTGGCTAAGGTCCACTTGACTTCACATTCCAGGA TGTCTGGCTCTAGTTGAATGATCACACCATTGTGATTATCTGGGTCATGA TGATGTCTTTTGTACAGTTCTTCTGTGTAGCCTTGCCACCTCTTCTTAAT ATCATCTGCCTCTGTTAGGTCCATACCATTTCTGTCTTTTATTGAGCCCA TTTTTGCATGAAATGTTCCCTTGGTATCTCTAACTTTCTTGAAGAGATCT CTAGTCCTTCCCATTCTGTTGTTTTCCTCTATTTCTTTGCATTGATCACT GAGGAAGTCTTTCTTATCTCTCCTTGCTATGCTTTGGAACTCTGCATTCA GATGCTTATATCTTTCCTTTTCTCCTTTGCTTTTCACTTCCCTTATTTTC ACAGCTATTTGTAATGCCTCCTCAGACAGCCATTTTGCTTTTTTGAATTT CTTTTTCTTAGGGACGGTCTTGATCCCTGTCTCCTGTACAATGTCACAAA CCTCTGTCCATGGTTCCTCAGGTACTCTCTCAGATCTAGTTCCTTAAATC TATTTCTCACTTCCACTGTATAATCATAAGGGATTTCATAACTGTGAGAA AAAAACAAACAAACAAACAAACAAACCCACAGAATATGCACCTAACATAA CTGCCAGCAGAGAAGTATCCCAGAATCTCATGTCCATCACCATCTTGTGG GGTTGGACAGGGAATAATGGGCTGCATAATTGGTGCTAAAGGTAAGGACC ATCATATAGTGCCTTGGCCAGGAATTGAATCTGGGTGTCCCGCGTGGGAG ATGAGAATTCTATTACTGAACCACCAATGTGGTGACCATGTATATTGTCA CCCTGCTTATTTAGCTTATATGCAGAGTACTTCATGAGAAGCACTAGGCT GGATGAAGCGTAAGCTGGAATCAAGATTGCTGGGAAAAATATCAATAACC TCAGATATGCTGATGACACCACCCTTATGGCAGAAAGCGAAGAAGAACTA AAGAGCCTCTTGATGAATGTGAAAGAGGAGAGTGAAAAAGTTTACTTAAA GCTCAACATTCAGAAAACCAAGATCATGACATCCGGTCCCATCACTTTAT GGCAAATAGATGGGGAAACAGTGCAAACATTGGCAGATTTTATTTTTTGG AGCTCCAAAATCACTGCAGATGCTGACTGCAGCCATGAAATTAAAAGATG CTTACTCCTTGGAAGGAAAGTTATGACCAACCTAGACAGCATATTATAAA GCAGAGACATTACTTTGCCAACAAAGGTCTGTCTAGTTAAGGCTATGGTT TTTCCAGTAGTCACGTATGGATGTAAGAGTTGGACTTTAAAGAAAGCTGA GCACCAAAGAATTGATGGTTTTGAACTATGATGTTAGAGAAGACTCTTGA GAGTCCCTTGGACTGCAAGGAGATCCAACCAGTTTCTCCCAAAGGAGATC AATCCTGAATGTTCATTTTAAGGACTGATGTTGAAGCTGAAACTCCAGTA CTTTGGCTACCTGATGCGAAGAGCTGACTCATTTGAAAATACCCTGATGC TGGGAATGCTTGATGGTGGGAGGAGAAGGCGACGACAGAGGAGATGTTTA GATGGCATCATCAACTCAATGAACATGAGTTTGGATAAACTCCGGGAGTT TTTATCACCAACTCCTGGAGTTTAGGACAGGGATGCATGCCTAGCATGCT TCAGTCCATGGGGTTGCAAAGAGTCAGACAGGACTGAGAGACTGAACTGA ACTGAAGGTAAGGACCAGGGGGCCTGAATGTCCTGAGGACCATCTGAGGG AGCTAATGTGAGATAGCAACACAAACTGTGGGATTGCCACAGAGAAAACA AAAGAGAACTTTCTCATGAAAGTCTCTAACACGCAGCCTGGCCTACTCAC AGAACAAAGGATTAAATGAATACCAAAGAAGAGCTAGCCGGCTGCATACA GGCCCCTTCTACCCTCCATCAGAGGCAGAGAGGCAGGCCAGTGACATCCA GAGCCAGAAAGCAAGGAGCTCCTGCAATCTTAGCCTTGGAGACCAGTATC CTCCACCAAACTGTGAGCAGGCTCCCAGTTGCCAACCATGTCTTGTTGGG ATTTTGGACGGTTGACATCTGCCAGGAGGGTCACAGCTTGAGATCAGCTC CCCAGAGGAGACACTCGGCATACCTGAGATGGTGCTCTCATGGCGCACCC GGGAATCTGAACGGCTGGGCATGGGGAGGTGATTAAGACACACGGTCCAC CAGGGACAATATGTTAGCCAAACACCTGCTTGCTTGAGCTGCTCAGACCT GTCAAGTGCACAAAACTCATGCCCAACTCAGTCTAGGCACTTTTGGAGTA CACAAGAAACTGAGTGGCTTAGACCTTGGAAGTGCACCAAATGCAGGGCC CACTTTGGACAATGTCCCCTGCAGAGCACCCTGAAGCCTGAACCATGTAG ACCCAGGAATCACACGCCACCTTGAGCTGGGGCAAACCCAGTGTGGTCAT AATATGTGAACGCTCTCTACACCTCCATGGAATTTGTTTGGAATTCCCTC CCTCCCCACAAGCAACTGAACCAATGACCCTAAATAATGAACCCCTTACC CCCCTGGCTTAGGGGAGGAAATTGGAAAACGGAAAAAATTTGGCAAAAAA AGGAAGCCAAATTAAAAACCAAAAAAAAGAAAAAACCCCCCTGGGAAAGT GACAAGGGCCAACCAAATTTAAATCCCGTGGATGTTAACTTTGTACCAAG ACTATTGGGAGGGGGACCTTTTAAACCCTTGGAAAAAAGAAACAAAAGAA AAACAAAAAAAACCCATTCTAAAAACGGGACACTGCACCCCCCCCCGTGG TCCCCAACACAACCCTCCAAAAAAAATTCCCCATAAAAAAATTTTTTTTA TATTTTTTTACTTTTTTTTTATAAAAAATTTCTTTTTTAATACCCCCTTT TTTTTTTTTTCTTTTTTTTTTTAAAAACATCATCTACATTATTTTCTCCC CCTCTC project fbnp AF 20040903 9018bp AGAAACGGTCATGAGTAGTTCTCATGACAGGTGCAACAGATTAAAACCCT GGTAGTTAACATTGACTAAGCATTGCGATGGGACCTATAGACCTTGAGAA AAAGTACAAGATGAAACACCTAACTATCTAAAACTGAACTGACCCCACAC TGTCCACAACAGCTTCAGAGAAATTCCTAGATATATTTTTTATTCTTATC ATTTTTAAAAGATCTTTGTTAATCCTTTAATTTTCATTTTTATAACATAC TATTACCTTGCAAAAAAAAAAATCCAAGTTTTAAAGAAAATTTCATATAT ATATATATGAAATATATATATATATGAAATATATATATATATATATATAT ATATAAATTTTTGTGACTGATTTTGTTTGGTATTTTTAATTTTTTTTTTG ATAGTCTAACCTCTACTCTAGATTTTTAATCTTTGGTTTTTGGTATTTGT TATCAATTTTGTACCTTTAAGAATCTAATCTTCAGTTTCCATTTTCACTT AAGGATGTGATAACTGGCTTGATTTTTCTTTTCCCTTTTGACTCTCCCTT TTCTCCCCCAGGTCACCTCTATCTCCTCCCTCCCCCTTCTCTTCTCTATG TAACTCTATGAATCTCTTTGGGTGTTCCAGACTGTGGAGAGCACTTAGGG AGTTGATTACTGGATAGAGTGCTCTCTCCATTTTTGACTCCTCTTCTCCT CCTAGTCACCTCTATCTCTTCCCTCTCTCTATCTCTATCTCTCTCCCACC CTCTTTTCTTCTCCATGTAACTCTGTGAACTTCTCTGTGTGTCCCTTGCT ATGGAGAATTGTTTCACCATTAATCTAGGTGCTGTATCATCTGTGCTGTC TGGATGGAGAAGTTTAGTGGCTACTGTAAGAATCATATTGAAAGTCAGAG GCAGGAGGCTTAACTTCAAAACTTGAGAACTTCAAAGAACCCCCAATTCC AGGGAACATTAATAGACAAATTTCACCAAAAACCTCCATAACTACACTGA AACCAGGCCCCACCCAAGAGCCAATAATTTCCAGAGCAAGACATGACATG CTAATTCTCCAGCAAATCAGGAACACAGACCTGAGCATTAAAAGATAAGC TACCCAAAGTCATGCCAAACCCAAAGACACCACAAAACTCACTACCGGAC ACTTCATTGCACTCCTGAGAGAAGGGATCCAGCTCCACCCACCAGAACAC AGACACAAATTTGCACAGGAAACGTTGACAAGTCACTGGTCCAACCCCAC CCACAATAAAGAGGAATCATGAACTTCCAGTCTACAGAAAGGGAATCCCA AACACAGAAATCCAAACAAAATGAAAAGGCAGAGAAATATACAGCAGGTG AAGGAACATGATAAATGCCCAACAAACCAAACAAAAGAGGAGGTGATAGG GAGTCTACTTGAAAAAGAATTCAGGATAATGATAGTACAGATCATCCAAA ATCTTGAAAACAAAATGGAGCTATAGATAAGTAGATTAGAGACAAGAATT GAGAAGATGCAAGAAATGTTTAACAAGGACCTGAAAAAAAATAAAGAAGA GTCAATCAATAATGAATAATGCAGTGACTGAGATAAAAAGGACTCTGGAG GAATCAACAGTAGAATAACTGAGGCAGAAGACAGGATAAGTGAGGAGGAA GATAGAATGGTGGAAATAAATGAAGCAGAGAGGGGGGGGGGGAAAGAATT AGAAAAAGTGAGGACAAATTCAGAAACCTCTGGGACAATGTTAAATGCCC CAATATTTGAATCATAGGAGTCCCAGAAGAAGAAGACAAAATGAAAGGGC ATGAGAAAATACTTGAGATAATAGTTGAAAACTTCCCTAAAATGGGGAAG GAAATAGCCACCCAAGTCCAAGAAACCCAGAGAGTCCCAAACTGATAAAC CCAAGGCCAAACACCCCAATAAACATATTAATCAAACTAATGAAGATCAA ACACAAAGAGCAAACATTAAAAGCAGCAAGGCAAAAGCAGCAAATAATAC ACAAGGGGATTTGCATAAGGATAACAGCTGATCACTTCATAGAAACTCTT CAGGCCAGAAAGGAACAGCAGGTCATACTTAAAATAATGAAAGAGAAAAG CCTACAACCTAGATTACTATATCCAGCAAAGATCTCATTCAAATATGGAG AAATTAAAAGCTTTATAGACAAGCAAAAGCTGAGAGAATTCAGTACCACC AAACCTGCTTTTCAACAAATGCTAAAAGATCTTCTCTAGACAGGAAACAC AGAAAAGGTGTATAAACTCGAACCCCAAACAACAAAGTAAATGACACTGA ATCATACTTATCAATAATTACCTTAAATGTAAATGGGTTGAATGCCCCAA ACAGAAGACAAAGGCTAACTGAATGGATAAAACAAGACCCTTATATATGC CATCTACAAGAGACCCACCTCAAGCCCAGGAACACATACAGACTCAAAGT GTAGTGCTAGAAAAAGATATTTCATGCAAATTGAAATTAAAAAAAAAAAA AAAAGCAGGAGTAGCAATACTCATATCAGATAAAATAGACTTTGAAATAC AGACTGTGAAAAGAGACAAGGAGACTACCTAATGATCAAAGGATCAATCC AAGAAGAAGATTAAGCAATTATAAATATATGTACAACCAAGATAGCAGCA CCTCAATATGTAAGGCACTTTAATATCTCACTCACACCTATTGATAGATC AACCAAACAGAAAATTACCAAGGAAACAAAAACTTTAAATGATACAATGG GCCATTTAGACCCAATTGATATCTGTAGAGAACTTCACCCCCCAAAATGG ATTTCATCACTTTCTCAAGTGCACACAGAATGTTCTCCAGGATAGATCAC ATCCTGGGCCATAAATCTTGCCTTGGTAAATTCAAAAAATTGGAATCATT TCAAGCATCTTTTCTGATAACAATGCAGTAATATTAGATGTCAATTACAG GGGAAAAATGTTAAAAATACAAACATGTGGATGCTAAATGACACATTTAT GAATAACCAACAAGTCATGGAAAAAATAAAAAAGGAAATAAAAGTACACA TAGAAACACATGAAAATGAAAATATGAAGACCCAAAACCTATACCAGTGA ACCAGTGAATTTTCTCAGTCGTGTCTGATTCTTTGGAATCCCATGGACTG TAGCTTACCAGGCTCCTCCATCCATGAAAATTTCCAGTCAAGAGTACTGG AGTGGGTGGCCATTTTCTTCTCCAAGGGATTCAGTAAAAGTAGTGCTAAG GGGAAGGTTCATAGCAATACAAGCTTACCTCAAGAAACAAGAGAAAAACC AAATAAATAACCTAACATTACACCTAAAGTGAAAAGCAAAGGAGAAAAGG AAATGCATAAGCATCTGAATTCAGAGTTCCAAAGAATAGCAAGGAGAGAT AAGAAAGCCTTCCTCAGCAATCAGTGCAAAGAAATAGAGGAAAACAACAG AATGGAAAAGACTAGAGATCTCTTTAAGAAAATTAGAGATACCAAGGGAA CTTTTCATGAAAAGATGGGCTGGATAAAGGACAGAAATGGTATGCATCTA ACAGAAGCAGTAGATATTAAGAAGAGGTGGAAAGAGTACACAGAAGAACT GTACAAAAAAGATCTTCATGACCAAGGTAATCATGATCGTGTGATCATGA TCATTCACCTAGAGCCAGACATCCTGGAATGTGAAGTCAAGTGGGCCCTA GAAAGCATCACTAGGAACAAATCTAGTGGAGGTGATGGCATTCTAGTTGA GCTATTTGAAATCCTGAAAGATGATGCTGTGAAAGTGCTGCACCCAATAT GCAAGCAAATTTGGAAAACTCAGCAGTGGCCACAGGACTGGAAAAGTCAG TTTTGATTCCAATCCCAAAAAGGCAATGCCAAAGAGTGCTCAAACTACCA CACAATTGCACTCATCTCACACTCTAGTAAAGTAACGCTCAAAATTCTTC AAGCCAGGCTTCAGCAGTGTGTAAACCATGAACTTCCAGATGTTCAAGCT GGTTTTAGGAAAGGCAGAGGAACTAGATATCAAATTGCCAACGTCCACTG GATCATGGAAGAAGCAAGCGAGTTCCAGAAAAACATCTATTTCTGCTTTA TTGACTATGCCAACGCCTTTGTGTGGATCACAATAAATTGTGGAAAATTC ATAAAGAGATGGGAATACCAGACCACCTGACTTGCCTCTTGAGAAACCTA TATGCCGGTCAGGAAGCAACAGTTAGAACTGGACATGGAACAAGAGACTG GTTCCAAATAGGAAAAGGAGTACGTCAAGGCTGTATATTGTCACCCTGCT TATTTTTTTATTTTATTTTATTTTTTTAAATTTTATTTTATTTTTAAACT TTACATAATTGTATTAGTTTTGCCAAATATACCCTGCTTATTTAACTTAT ATGCAGAGTACATCATGAGAAACGCTGGGCTGGAAGAAGCACAAGCTGGA ATCAAGATTGCTGGGAGAAATATCAATAACCTTAGATATGCAGATGACAC CACCCTAATGGCAGAAAGTGAAGAGGAACTAAAAAGCCTCTTGATGAAAG TGAAAGAGGAGAGTGAAAATGTTGGCTTAAAGCTCAACATTCAGAAAGCT AAGATCATGGCATCTGGTCCCATCACTTCATGGGAAATAGATGGGGAAAC AGTGGAAACAGTGTCAAACTTTATTTATTTATTTATTTTAGCTCCAAAAT CACTGCAGATGGTGACCGCAGCCATGAAATTAAAAGACGCTTACTCCTTG GAAGGAAAGTTATGACCAACCTACATAGCATATTCAAAAGCAGAGACATT ACTTTGCCAACAAAGGTCCGTCTAGTCAAGGTTGTTTTTTCCAATGGTCA TGTATGGATGTGAGAGCTGGACTATGAAGAAAGCTGAGCGCTGAAGTATT GATGCTTTTGAACTGTGGTGTTGGAGTAAACTCTTGAGAGTCCCTTGGAC TGCAAGGAGATCCAACCAGTTTATTTTAAAGGATATCAGTCCTGGGTGTT CTTTGGAAGGAATGATGCTAAAGCTGAAACTCCAGTTCTTTGGCCACTTC ATGCGAAGTGTTGACTCATTGGAAAAGACTCTGATGCTGGGACGGATTAG GGGCAGGAGGAGAAGGGGGCGACAGGGGATGAGATGGCTGGATGGCATCA CTGACTCGATGGACGTGAGTCTGAGTGAACTCTGGGAGCTGGTGATGGAC AGGGAGGCCTGGCATACTGCAATTCATGGGGTTGCAAAGAGTCGGACATG ACTGAGTGACTGAGCTGAACTGAACACCTAAAGCAACTAGAAAAAGAAGA AATGAAGAACCCGTGTTTAGTAGAAGGAAATAAATCATTAAAATTAGGGC AACAATAAATGGAAAAAAAAAAAGGACACTACAGCAAAAGTCAACAAAAC CAAAATCTAGTTCTTTGAGAATATAAATAAAATAGACAAACCATTAGCCA GACTCATCAGGAAAAAAAGAGAGAAGAATCAAACAACAGAATTAGTAATG AAAATGGAGAAATCACAGTAGACAACACAGAAATACAAATAATCATAAGA GACTACTGTCAGCAACTACATACCAATAAAATGGACAACTTTGAAGGAAT GGACGAATTCTGAGAAAAATATAACTTTCCAAAACTGAATCAGAAAGAAA TAGAAAAACTTAAAGGACCCATCACAAGCATGGAAATTGAAATTGTATTT AAAAGTCTTCCAACAAACAAAAGGCCAGGACCAGATGGCTTCACATGTGA ATTGCTAACACCTATCCTACTCAAACTGTTCCAGAAAATTGCAGAGGAAG GTAAACTGCCAAATGCATTCTATGAGGCCACCATCACACTAATGCCAAAA CCAGACAAAGATGCCATACACAAAGAAAACTACAGGCCAATATCACTGAT GAACATAGATGCAAAAATCCTCAACATATTCTAGCAAACAGAATTCAACA TTTTAAAAAGATCCTACATCATGACCAAATGGGCTTTATCCCAGGGATGC AAGAATTCTTCAATATTTGCAAATCAATCAATGTGATACATCACATTGAC AAGTTAAAAAATAAAAGCCATATGATTATCTCAAAAATGCAGAGAAAGCC TTTGACAAAATTCAACATCCATTTATGATAAAATCTCTCCAGAAAGCCAG TATAGAAGGAACATACCTCAACATAATAAAAGCCATATATGGCAAACCCA CAGCAAACATTATTCTCAATGGTGAGAAATTGAAAGCATTTCCCCTAAAG TCAGAAACAAGACAAGTGTGCCTGTTCTCACCACTCTTATTCAGCATAGT TTTGGAAGTTTTAGGCACAGCAATCAGAGAAGACAAAGGAATAAAAGGAA TCCAGACTGGAAAAGAATAAGTAAAACTGTCACTGATTGCATATGATATT ATCCTTGACATAGAAAACCCTAAAGAGACTACCAGAAATTACTAGAGCTA ATCAATGAACACAGTAAAGTTGCAGGATATAGAATTAATACACAGAAAGC CCTTGCATTCCTATACCCAATAATGAGAAAACAGAAAGAGAAATTAAGGA AACACACCCATTCAGCACTGTGACAGAAAGAATAAAATGCCTAGGAATAA ATCTACATAAATAAACAAAAGACCTATATATATATATATATATATATATA TATATATATATAACTATAAAACACTGATGAAAGAAATCAAAGAGAATGCA AATAGATGGAGAAATATACCATGTTCACGGATTGGAACAATATAGTGAAC ATGGAACAATGTTGATCAATGATCAACATTGGATCAATATAATGAAAGTA AGTACACTACCCAAAGCAATATACAGATTCAACAAAATCCTTATCAAGCT ACCAACAGTATTTTTCACAGAACTAGGACAAATACTGTAACAATTTGTAT GAAAATATGAAAAACTTTCAATAGCCAAAGCAATTTGAGAAAGAAGAATG GAACTGGAGGAATCAACCTGCCTGATTTCAGACTATACTACAAAGCTGCA GTCATCAAGACAGTATGGTACTGACACAAAAACAGAAATATCAGTCAATG GAACACAATAGAAAGCCCAAAGATAAATCCAAACACGTATGTACACCTAT GTGAACCTTACCTTTGACAAAGGAGGCAAAAATATAAAATAGAGAAAACA TAATCTCTTTAACAAGTGGTGCTGGGAAAACTGGTCAACCACCTGTAAAA TAATGAAATTAGAACACTTTCTAACACCATACACAAAAATAAACTCAAAA TGGATTAAATATCTAAATTTAAGACCTGAAATCATAAAACTCCTAGAGGA AAACATAGGCAAAACACTGTCTGAAATAAATCACAGCAAGATCCACTATG ACCTACCTTCCAGAGGAATGGAAATAAAGCAAAAATAAACAAATAGGACC TAATTAAGCTTAAAAGCTTTTGCACTCTCTGAAATAAATCACAGCAAGAT CCACTATGACCTACCTTCCAGAGGAATGGAAATAAAGCAAAAATAAACAA ATAGGACCTAATTAAGCTTAAAAGCTTTTGCACTCTCTGAAATAAATCAC AGCAAGATCCACTATGACCTACCTTCCAGAGTAATGGAAATAAAAGCAAA AATAAACAAATGGGACCTAATTAAACTTAAAAGCTTTTGAAGGAAACTAT AAGAAAAGTGAAGATACAGCCTTCAAAATGGGTGAAAATAATAGCAAATG AAGCAACTGACAAAGAAATAATCTCAAAAATATAAAGTAGTTCATGCAGC TCAATACCAGAAAGATAAATGACTCAATCAAAAAATGGGCCAAATAACTA AACAGACATTTCTCCAAAGAAGACATACAGATGGCTAACAAACACATGGA AAGCTGCTCAACATCATTCATTATCAGAGAAATGCAAATCAAAACCACAA TGAGGTACCATCTCATGCCAGTCAGAATGGCTGCTATCAAAAAGTCTACA AAATTTAAATATTGGAGAGGGTGTGGAGAAAAGGGAACCCTCTTACACTG TTGGTGGGAATGCAAACTAGTACAGCCACTATGGAGAACAGTGTGGAAAT TCCTTAAAAACTGGAAATAGAACTGCTATACAATCCAGCAATCCCACTCC TGGGCATACACACCAAGAAAACCAGAATTGAAAGAGACATGTGTACCCCA ATGTTCATTACAGCACTGTTTACAATAGCTAGGACATGGAAGCAACCTAG ATGTCCATTGGCAGATATATGAATAAGAAAGCTGTGGTACATATACACAA TGGAATATTACTCAACTATTAGAAGAATGAATTTGAATCAGTTCTAATGA GGTGGATGAAACTGGTGCCTATGATACAAAGTGAAGTAAGTCAGAAAGAA AAACACCAGTACAGTATATAAATGCATATATATGGAATTTAGAAAGATGG TCACAATGACCCTATATGTGAAACAGCAAAAGAGACATAAAGAACAGACT TTTGGACTCTTGGGAGGAGGCAAGGGTGGGATTATTTGAGAGAATATTAT TGAAACCAGTATATTACTTTATGCAAAATCAATGGCCAGTCCAAGTTCGA TGCATGAAACAGGGCACTCAAAGCCTGTACACTGGGACAACCTAGAGGGA TGGGATGGGGAGGGAGGTAGGAGGGGGGTTCAGGTTGGGGAACACATGTA CACCCATGGTGGATTCATATCAATGTATGGCAAAACCAATACAATACTGT AAAGTAATTAGCCTACAAGCAAAATAAATAAATTTATATTAAAAATAAAA TTAATTAATTAATTAAAAAATATCTCATTGGTATATCTCTGTAATTATTC AAGAGGTAAGGACATAAGTAATAAGCTTTGATGAATAGGCAGTTGTTTCT TTTAATACTTGCTGAAGAATCCCTGGGCAAAAGCTAACGGGACCTTCTTG AAAGCAGCTTGCTTCCAACACTCATACCTGATGCTCATACACGATCACTT

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnp.fa (2013-03-31)
    Open archived version from archive



  • ATTTTGTTTTCAAGATTTCTGATCATCTTTACTATCATTATAACACATTC TTTTTCAGGTAGTTTGCCTATTTCCTCTTCATTGATTTGCTTCTGTGTTT CTAGTTTGTTCCTTCATTTATTTGGTATTTCTTTGCCTTTTCATTATTTT TTTTTTAAACTTATTGTGTTTGAGGTCTCCTATTCCCAGGCTTCAAGGTT GAATTCTTTCTTCCTTTTGGTTTCTGCCCTCCTAAGTTTGGTCCAGTCAT TTGTGTTAGCTTTGTATAGGTTGAGATTTGTGCTGAGTTTTTTGTTTGTT TTTCCTCTGATGGGCAAGGCTGAGTCAGGTGGTAATCCTGTCCGTGAGAT GAGGCATCCTGCACAGGGTGCTACTGGTGGTTGGGTGATGCCAGGTCTTG TATTCAAGTGGTTTCCTTTGTGTGTTCTCACTATTTGATACTCCCTAGGG TTAGTTCTTTGGTAGTCTAGGGTCTTGGAGTCAGTGCTCCCACTCCAATG GCTCAGAGCTTGATCTCTGATCAGGAATGAAGATTCCACAAGTGGTTTGT TATGGCATTAAGTGAGATTAAAACAAATATCCAAAACATGAAACCAAAGA TGAACCCCAGACAAATGGCAGTTACAAAATCAGGCAAATAACAACTAAAA TAATGGAATATAAACATATACATATACACCCATGAGCAAATTCAAAACAG TCCAACAAAAATAAAGTACAATAGATTGACCCAGCAAACAAACAAAATCA AAAATTATATTTACCAGTTAAGAATAAAACTAACAAAAGCACAAGTAGAA AACAAAACTAAAGCAATGAAAGCAAAACTAACAAATATGTTGAGAGGAAA GGAAAGAAAGAAAAGAAAGAAAGAATAGATATGCAAAGTTAAATAGAGGT AGATGAAAAAAATTTATATACATTAAAGATGAACTGCAAGGGGAAAAGAA CAGTAGGGAAGGCAAACAAAGGAATAAATGTAGAAAAAATATAATAGGTT TAAAAAAATTAAAATTATAAAAAAGAGAAAGAAAAAAATACTGGAAGAAA AAGAAAAAAGGAAAACTTCAGATATCTCAAAAGCCCAACGTAAAGGCAGA GGTTTATAACAGCAATAAAAAGTGTGACTGAATATATATATATACGTATA CACCCATAAACAAAATCAAACACAGTCCAACAAAAATAAAATACAATAAA TTGACCCAGCAAACAAAGGAAACCAAAAATTATGTCTACCAGAATAGAAC TAACTAAAGCAGAAACTGGAAAACAAAACTAAAGCAAGATGCCAATTGGG GAATAAAGCAGTGAAAATAAAACTAACAATTATGTTGAGAGGAAAGGAAA GAAAGAAAAGAAAGAAAGAATAGATATGTAAAGTTAAATAGAGGTAGATA AAGAAGATTTATATACATTAAAGATTAAAGGGGAAAAGAACAGCAGGAAA AGCAAACAAAGGAATAAATGTAGAAAAATAATAATAGGTTTAAAAATTAA AAATAAAACGAGAAAAGAAAAAAAAGGAAAACTCTCCAGAAGTGCAAAAG CCCAATGTACAGGCAGAAGTTTATAACAACAATAAAAAAATGTGACTGAG AAAAACAAAAAAGAAAAAAAAAGCTCAAAAGCTTAATTAGATTCATAGTG CCAATAAAATCAACAGTTACAACAGAGGGAGGATAAAGGAAAAAAAAAGA AAAAAAATCCAAAAGAATCTAAAGAACAAGTCAAAACATAAGAATTTAAT AGATGTTTTTCTCGAGTCACTGCTGTCCGAGTCCTTTCCCTCTCTGGGAG TCACAGTCCACCTCACCTCTCTAGGATGCCCTCCAACACTGTGCTGATTT CTGGACCTGTTGTGGGGGCAGCTCAGATTCTATTCTGGTCCTACTCTGTG TTCTTGCCTCCAATATCCACAGCTATCAGAATTAGTGCGTTTTCTTTTGT GGGAGCACTTAATGACCTTTTATATATTCCATAGACACAGAGTCTGCCTA GTTGATTGTGTGGATTTAATCTGTAGCTTGTACAGCTGGTAGAAGGTTTG GGGTCTTCTTCCTTAGTCACACTGCCCCTGTGTTTCAATTTTATTGAAAT TGAAACTGAGGTGGTTTTATTTCCACCTCTGCATGTGGGTCGTCCCCTGG GGTTTGCTCCTGAGGCTACCCTGGAAGACTTGGGTTTGCCCCTCTGAGGG CCAGGTGTGGAGCTGGTGCAGCTGCTTGGGTTGCAGGGGTTCTGGCAGCA CCAGATACTCAGGGGAGTTGGCGGCTAGGGCAGCAGGAAATATAGTGCTC TAGAAGGGTATGGCAGCCAGTATTGGCCAATATGCTCCAGTATTCTTGCC TGGAGAACCGCCCTCTCTGACAGAGAAGCCTGGCAGGCCATGGTCTACAG GGTCGCAGAATCGAACACTACCAAAGTGACCTTGCGTGCATAGATGCAAT ACTTTTTTTGCCTGTGGCAGCTCAGCCCCAGTGAGTTGAGCGTGAAGGTG GCATGGCTTCTTGGCTTGCAGGGACCCTGCTGGCGCCAAGTGTACAGGGA CACAGACTGCCTCAGCCACAAGAGTTATGGCCCTATCAGAGTCTTTTTCT GAGCCTCTCTAGCTGGTGATCAGAAGGCCTCTTTGGCCAGTCTTTGTCCG TAGCTCCGCCCTTTCAGGCACTCAGAGGGCTCCCTTGCCTGGGGTCCTTT TCTGTTGTTCGGTTCATCAGGCACATAAAGGGCCCTGCTATGGCTACAGT CCTACTCTGTAAATCAGCACGTCAGGCACTTAAAGGGGCACCCTGGACAG GACCCTCTTCTGTAGTTCAGTGCATCAGCAGGTGTTTGATGGGCCAGCCT CTCTATTGTTCAGCTGCTGATGCTGGCATGTGGGGAGAGAGAGGCTGCGG TTAGGGCTCCATCCCCTAGCATGACTCAGCAGTACTGCCTTGCTTCCATG GCTGCTTGGCTTTCCTCCACAGGCATTTCCCACTACAGTCTCCTCCCTCA CATCCCCTCGATCCGTCTCTCCACAGTCAACAGTAGCCCTCACCCTGGAA TTGCTCCACAATCCGTCAACTCCAGCTCCCAGCCATTGCCCCTTCCAGGG AATCTACATCCCTGTCCGGGGTATGTATGGCTGCGGCAAGGACTGTCTGA ATCCGTTTCGGCTGCCACAGATCAGCTGTTTCACTCACAGCCTTAAATGT TTCTCTGACTCAGACAATTGCCCGGATGTGGGGATCGGACCCCTGCTTCA GTTCCCCCACCTGCTGAGGGCAGGTCCAGTCCTTCTAACACTCCTGTTTT CCCCCTAGTTCCTTCGTCCTACCGAGTTTTGCGTGCTTCTATATATTCTT TTCCTCCTGTCTGCTCTCAGCTGGTGTTCTGCATGAACTTCTATGTCTGA AGGTGTGTTCCTGATGTATCTGTGGAGAGAGATGTACTCCACGTCCACCT ACTTCTCTGCCATCTCATTCTTTTTTTTATCCATTTTAAAATGTGTACAT TACTTATTTACTTGTAGGAGTTCTTAATGTAGTATTATATAAAGTTACAA AGTTACCTGTTATATAATTATCTTTCTAACATAGTACATTGTAAAAAGGT AGCATTCTGTTGCTATCAATTTTCATTCATTAGTCAGGAGAAGATTGTGT CTAGGAATGTGTTAGATACCTTATCCTAATGTGCCTTTCTCTTTCACTGT TTGCTCTCTAAAGTAAATCTCAGGTCGTTTATGACTCTAAGACACTTTTA AACACATAACATTTTTATCTAAATGGAAAACGTACATTTTATCTAAATAG AAACATAATTTTTATACCATCAGGTGGAAAAAAGATATGAAGAAAACTGT TAAGTATATTGAATTTTTGAATAGACAGTAATACTAAAGGGGGACCAAAC CTATCATCTGTCCACTTGAAATATGATTGTTTTAAGTTATTACCATAGCA TCATAACTGCTAAAATGAATATAATGTTTTGGGTTGACTTTTTTTTTCTG ACTTTTTGGTGACAGTTATTCTGAAGAAACACTCAACAGTTAGCTACAGG GACAGGGGAGCCTGGTGGACTGCCATCTATGGGGTCGCACAGAGTCGGAC ACAACTGAAGTGACTTAGCAGCAGTAGCAGCAGTATGATAACATCTGTAG GAAAAATATGTTAGTGTATATAGATTGTTAGGTAGAATAGTTACATAACT TATTATGTCCCTTCCCCTGGTGTATGCTCACTGATTTCTTGATATTTGAG AGAAGAGCATGTGTGTAATTGGGAAACGTTGCTTTTATGATTTATAAAAA TTTTTTCCTTATTTGTTTCTTTTTGGCTTGTGGTGGGTCTTCATTGCTGC ATGTGGGTTTTTCTGTAGTTGCAGAGAGCAGGGGCTCCTCTCTAGTTGCA GTGCACCGGCTTCTCAATGCAGTAGCTTCTCTTGTCGCAGAGCATGGACT CCAGGGTGCAAGGGCTTCAGTAGTTTCGGGTCCTGGGTTGTCCAGAGCAC GTGCTCAGTAGTTGTGGTGCACAGGCTTAGTTGCTCCACAGCATGTGGGA TCTTCCCGGATCAGAAATCAAACCCATGTCTCCTGCATTGGCAGGCGGAC TCTTCACCACCGAGCCACCATGGAAGCCCTTGCTTTTATGATTGTATGAA CTTTAACACTGCTAGCCCTAAGAACTTTATAGTGTTAAACTTTGGTGTTA AAAACCATGAAGGTATAATATAAATGTTTTGAAAGATTTAATTTGATGAG GTTTTAAAAACTTATTAGATTGTGAAGTTTAAAATATATAGAGTGTAAGA AACAGAAATATACAGTTCAGTGAACTTTTATGACACAAATAACCATATAA CGGTCACTTGGGTCAACAAATAGAATCTTACCTGTATTTCATTAGTTTTC ATTGGTGCTCCCTTCCAAAACCTTTTCTTTTTTCTCCATCACTGAAGATA ATCAATAACCTGATATTTCTCAGTACTTTTTTGTCTTTATAACTATGTAT TATTAAACACCATTGCTTGGGTTTACTTAATTCTTTTTAAAATTTATGCA ATGGAAGTATGGAGTATACCTTCATGTTTGGGGTTGGTTTTTTTTTGGTC AACATTATGTAAAATTGTAGAAAACTGTGGATCATTTATTTTTGTTGCTG TGTTGTAATCCATTGTATAAATACATCACAATTTATCCATTCTGCTCTTT TCTTCAGTGCATTCTACTGTTGATGGACTTTGGGCTGAATGGTGTTTCCA GGCTCTTGGTGTACATATGCATGCGTTTCTCTTGGGTATATATAGGTAGA AATGGAATCTCTAGGTCTTAGAATATGCAAGTATTTAAATGCAATGTTTG TCAAATGGTTTTCCAAAGTGGTTGTACCAATTTATAGACAAATGTAGCCA TATATGAGCAGTTCCACTGTCTTATATTATTCATTTATACAAGATATCAG CAGTCTTTTTTAAAATGATTTTGTGGTGTAGTCTCTAAGTTGTGTTCGAC TCTTGCAATGCCATGGACTGTAGCCTGCCGGGCTCCTCTCTCCATGAGAT GCTCCAGGTAAGAATACTAGAGTGGGTTGTCATTTCCTTCTCCACGGGAT CTTCCCGACCCAGGAATTGAATTCGGGTCTCCTGCATTGCAGGCAGATTC TTTACCAACTGAGCTACAAGGGAAGCCCAAAATGATTTTAATTTATTTAT TTATTTTTGGCTGTTCTTGGTCTTTGCTGCTGGGCTGGCTTTTGCTCTAG TTGCAGTGAGTGGGGGCTCCTCTCTAGTTGTGGTCTGTGGGCTTCTCATT GCAGTGGCTTCTCTTGTAGCGCACAGGCTCTAGGCGCCCAGGCTTCAGTA GCTGCAGCACGTGGGTCAGTAGCTGCGGCTCAACGGGCTCTAGAGCACAG GCTCAGCAGTTGTGATGCACAGGCTTTGTTGCTCCTTGGCATGTGGCATC TTCCCAGATCAGTGATTGAACCCACGTCTCCTTCACTGTCAGGTGGATTC TTTACCACTGAACCATCAGGGATGCCCTAGCAGTCATTTTAATTTTAGAA ATTCTGGCATATGTGGGGTGGTATCTCACTGAGGTTTTAAGTGGGATTTT CCTATGATGATGTTTGCTGATCATTTGTATATCATTGTTGAATTTTGTTT GCCCATTTTTGTATATAGTTGTTTGCCTTTTTTAAAATTGATTTATAGGA GTTATTTTTATATTATAGATGTAAGCCCTTTAGTGAAAGTAAAAAGTGGA AGTGTTAGTTCTCAGTCATGTCTGACTCTTTTTGACTTCATGGACTGTAG CTCCTCTGTCCCTGGGGATTCTGGAGGCAAGAATACTGGAGTGGGTAGCC ATCCCCTTCTCCAGGGGATCTTCCCAACCCAGGGATCAAAACCAGATCTC CTACACTGCAGGCAGATTCTTTACTGTCTAGCCACCAGGGAAGCCCCAAG CCCTTTAGTTACATGCGATACAAATATTTCCGCCCCCACCCCCTCATCGT GGCTTGCTTTTTTACTCTCTCAGTGGTATGTTTTGATGAGCAGAAGTTCT TAATTTTTATACAGTCCTCTTTTCCCTGCTTATGAATGGTCTGTGCTTTT TGTCTGCTGTTTAAGAAATCTTTATAGACCCTGTGAATTTAGATATTCTC ANTATAATACTTCCTTGAAGTGTCCTTGTGATGAACTACTGNNNAGTCAT TCCCCC project fbnq AE 20040903 11136bp GGCAGTGATGATGCAGTAGTTCTCACAGTCAAATCTTTGATCTTAGAGGA GGAGTTTAAAAGTTTTTCTTTTGTTTCTTGTCCATTTTACCTACTTAAGA GTTCTGGAATCCCCCTAGTGGGGTTAAGCCAAGGAGGTCACGCTCTTTGG CCTAACTGTTGCCGCAAATAATTGCTAGTCATATATCTCTGGGTAAATTT TTCTAGCCCCTTAAATATATATATTTTAAAACTGGGGTATAGAAAAGACT TGTTTGGCTTTTAATATTAGAGGGAGGGGTCCCTTTTGGCCCATTTAACC TGAGGGTAGTATAATAAGGGGCTTCTCCAGTGGCTCAGCAGTAAAGAATC TACCTGCAATGCAGGAGATGCAGGAAGATGTGGGTTCGATCCCTGGGTTG GGAAGATCCCCTGGAGCAGAGCATGGCCATCCACTCCAGTATTCTGGCCT GAAAAGTCCCATGGACAGAGGAGCCTGGTGGGCTACAATCCATAGGATCA CCAAGAGTCATATATGACTGAAGGGACTGAGCACAGCACAGCACAGTGTA ATAATATCAAATCTTGTTTTCATCACATAAATATCCATTTTATTTCTCCC ATTTTAAATAACCATCTAAATATTTCTTAACTCCTTTTAAAATTTACCTT GTAGAAAGTAATAGCTAGACTTTCCTTACAAGTTTTTTGTTAACATTGAT TACTCTAATACTCTTGTTAGTATCTGTAAGACCCATTGAGGGGAAGCAAA GAATACAAATGAAGCTTCTCAAACCAGTTTTTCTTATTTGTTTACTTATT TTGTTTTCCTAGACTGTAATGAATGTGTCTCCATTGATCATCAAGGGGTT CTGAAGTCTTGACATCTTGTACTTTTTCATGGAATCATTTTAGATTGATT CCTATGCCTGTAGACATCTTTCTAAAAGTTATTACAAATAACATGAGTTT CCCTTATACCTGTTTCTTAAACACTAAACCTGAGCTAGGTTTAGTGTTTA AACATAGGTTTAGTGTTTAAAGTATAAGCCACTCTTTAAACATGGCTTAT ACTTTATAAAGGAGAAGGCAATGGCAACCCACTCCAGTACTCTTGCCTGG AAAATCCCATGGACAGAGGAATCTGGTGGGCTACAGTCCATGGGGTCGCA AAGAGTCGGACATGACGGAGCGACTTCACTTTCACTTCACTTATACTTTA TTCACTAGAGCAGAGACTCAGAGCTACAAACACAAGTTTTATGAATAATT CAGACTTCTGGGCTTAGGAAGCAAATAATACAAGTAAAGAGAGCAAGAAT AATTATTCTAAAACACTGAAAAATCTTAATATGTGCATTTGCTTGATACT GTGAGACAACAGTCAAGAGTGAAGTTAGAGAACAGAATCTGTTTTCCAGA TTGAAACAGGGAATGTTGATGTGGCACTTAACCTGTTGGTTTGAAACCAG TGAGCTAACCTATGGTTTGTCCATGGTTAACTACCCATAAATAATTACCC TTATGTATCTGTTACTTTACCCATTCATCTGTCTTCAATAACCAACCATA TAATGAATAATTGAAACTTGGCTCAGTGAATTTTAGTAATGATTGCTTAT TGCTTTCCAAATGACTGCATTAGAAAAATTATCAGGTTTGGATATATGTT TTTTGAATCCTAAGTTGTTGAAAAGTATGATTTAGCTTACAGAGCAGTTG AATGTGTGAATAAAATATTAATTTTTGAAGAATATTCTTCCATTTAGCCA ACAGATATATACATTTTAATAGTGAGATACATTATCAACATTCATATGTG AACAATATAAATTTTTTATTGATAATTTTGACTTAGTTATGACTCAGATA TAAATTATGTAATATGAATTATTTATTTACATCTGGTTTTTTGGTCAGTG CATAAGTTTTATGATGTGGAATTAAATGCTAGCATCTCAAAATTATGTAA TTATTTATGTTGGGTCTCAGTAGACAAAATTTAACATATTAGGATGATGC TTGATGTTAGTTGTAAAATAACGGAGGGCAGGTGGACAATACTAAACTAG TCCACTGGTTCTTTTGAGCTAGTAATTAAGTTAAAAAAATTTTTTTTCTA AACATCTCAGGCAAGCTAAATATGAGATGCAAGACTTGTAGTGAATTTAG AATTATAGTTAATATGCAGTATAAGCTCATCAAATATACTAAAGGATTGT TTTTGGCTTTAATACTTAATATGCTATTTAAGCAGAATAGAGGGCATATA GCTTACTCAGTGATACATGAAAATATTCATTTTAACAGGTAAACATTGGG AAGATGGATTCACCCATTGAAAAGTGGAACCTAATAATTGGCAACTTGGC TTTAAAACAGGTAAGTGATATGTATATGGGTATACACACACATATATTTA TGAACAAATGATAGAATAAATGGATAACTTCTGAAAGTTTTCTTTTTCTA GAAACATCACATTTTTCTAAATATGGAAAATGTATAACATACAAAGTATA GAGTAAATATAAAAAATATTTTCTCCCATATGTAATAGAGCCAGAATTTG AGTTAATATGTGTACAAATAAATATGTAGCACTTCATTGCTTAGATGCTA TTTTTCTTTGACTTTTTAAAAGTAAATCTTCTAATTAAACTTCGCTCATT TTTATATGATAGGATGTGTAAGCTGAATTTTCCTTAATTTGTTAATATTA TCAGTGTTAATACAAATGAGCACATTAAATTGTCAATTATATATAGATCA TCCACAGGTCTTTCTAATCTCAGGGGAATCTCTCTTCCTCTCCCACTACC TGCTGCTATCCCCAAGACACAAGACTGCAGCTCCCAGCACCTCTTTAGCA AATCTGAGTTTATGAAGTGCTCGCTAATTAAAAAAAATTTTTTTTTTTAA TTTGGCTGCGCTGTGCAGCATGTGGGTTCTTAGTTCCCCTGCTAGGGATC AAACCTGTGCCCCCTGCATTGGAAGTACAGAGTTTTAACCACTAGACCAT TGGAGAAGTCTGGCTCAACTAATTTTCATGTTAGGTCAACTCAGACGTAA TGTTGAGAACGTGGTTGCAGAAAAGAAATTTCATGTTATGTTCAAAGACA AAGAAAGAAAGGCAATTTTGGGATATAGGCTTTTAAAAGGTATCTGTGTT TCTAAGATCACAGGCTTAGAAACAAGAAAATTTGAAATCTAGTCTCAGCT CTAGCAATCACCAGCTATATAATGTTTGTTAATTTAGCCTTTCTTCTATG TTTCATTTTCCTCTTCATTTCCATAGTGTCGCACTAGGGATACCCAAGAT CCTTTTCAGCTTGAAACTGTAGGAATCTATGCTGGAGTAATAAGCAGTAT ATCCAACAACCAGTAGGCTACTTATAAACTAATAAATGAAAATTTGAAAA TATATCCTATTTTATTCTTTAAATACTGTAAACTCTTACTGAGTAATATG AGTTAGACTATAAATTATTCTAATAATTTTCCACCTCTGCTTTTGTTTTA TTTTCTTAAGAAGCGCTCATCCTTTTTAAAAGATTTTTATTTATTTATGG CTGTGCTGGGTCCTCATTGCTGTGTGGGCTTTCTTTATTTACAGCAAGTG GGGGCTCCTCTCTAGTTGCGGAACGCGGGCTTTGCATTGCAGTGGCTTCT CTTGTTGCAGAGCACAGGCTCTAGGTGTGCAGACGTCAGTAGTCGTGACT CATGGGCTTAGTCGCTCGTCAGCATGTGGGATCTTCCCAGACCAGGGATG GAGCCCCTGTCCCCTGCATTGGCAGGCGGATTCTTAACCACTGGACCACC AGGGAAGTCCCCATCTCGCTTTTAACTTTTCCTTTCACTCTTAGTCTCCG CCCTTCCCCTGCCATCCTCTCTTTCCATAACTGTTGGTCAGGATGAGAGC TAGAGATGGCTGCGGTTTCACTGATCCTATCATAATAGTGCCACAGCCTG AAGTCTGTGTCTGTGTCTCACTCCACCAAGGATGCATGAGAAACGGGGAA CCCCACACGGGCTCATCAGGACCCAGCTGGTATAAGCCAGTGAGGCAGCA ACTGGTTGGAGTCTAGTTACCTGTAGACAAAAGTAGAGGGGAGAAGAAAA TAAGGTCAGGTGGGGGTGACAGTGGTGCTGTCTCTGAAGCTTTATCTGCT CCAGCTTGTGAGGGAGTAGACGGCTGGCTGGGGGAGTAGGGGGAGCTGGC AGAGCTCCTCTGACTTGAGGCTGGCTGTGGACGGGATGGGTGGGGAGGGA TGAGAAGGACAGAGGCACCTCGTGCTGGCATTAGCTGGCGTGCGTGTTCT TCTGACTATTAAATGGGATCCCAAGCAGATGACCATCACAGAATTTCTTC ACAGTTGTACACAGTGGCCATCTCAACCTGTCCATAAATTGTCAAATAAG TAGGTATTTATTTATTTTTTGGGGGGGAACCCCAGAGTTCCCAATCTCAT TGAAGAGTCATTCCCTCGCCAGGATAGATGTATCCTGTGTTCACGTCTAT TTAGGCCCATGCCTCCTGTTAACCTCTACAGCTCCTCCTTAACCTGGAGT TTGCTCTTCTCTTGGGTACAATTGGGTCTTTCCTTTGCAGGTTTATACAC TAGGACTTCTTTATTTCAGCTGTGTGTGTGTTACAATGTCTTCCATAGGC TCCCTAGTTCTGTATTTCATTTCTAAGAAACAAAAACTTTGCATTTTATT TCTAAGAAAAACCTTGGAGTCACAGTATTAGAATTTAAATTATTAATTTT ATCACTTTTACATATATTATTTACTAACCAGGATCAGGAATGCAGGTCAG GAAGCAACAGTTAGAACTGGACATGGAACAACAGACTGGTTCCAAATAGG AAAAGGATTATGTCAAGGCTGCATATTGTCACCCTGCTTATTTAACTTAT ATGCAGAATACATCATGAAAAACGCTGGACTGGAAGAAACACAAGCTGGA ATCAAGATTGCCAGGAGAAATATCAATAACCTCAGATATGCAGATGACAC CACCCTTATGGCAGAAAGTGAAGAGGAACTAAAAAGCCTCTTGATGAAAG TGAAAGTGGAGAGTGAAAAAGTTGGCGTAAAGCTCAACATTCAGAAAACC AAGATCATGGCATCCGGTCCCATCACTTCATGGGAAATAGATGGGGAAAG AGTGGAAACAGTGTCAGACTTTATTTTTATGGGCTCCAAAATCACTGCAG ATGGTGACTGCAGCCATGAAATTAAAAGACGCTTACTCCTTGGAAGGAAA GTTATGACCAACCTAGATAGCATATTCAAAAGCAGAGACATTACTTTGCC AACAAAGGTCCGTCTAGTCAAGGCTATGGTTTTTCCTGTGGTCATGTATG GATGTGAGAGTTGGACTGTGAAGAAGGCTGAGTGCCGAAGAATTGATGCT TTTGAACTGTGGTGTTAGAGAAGACTCTTGAGAGTCCCTTGGACTGCAAG GGGATCCAACCAGTCCATTCTGAAGGAGATCAGCCCTGGGATTTCTTTGG AAGGAATGAAACTTTAGTTTCAGCTAAAGCTGAAACTCCAGTACTTTGGC CACCTCATGAGAAGAGTTGACTCATTGGAGAAGACTCTGATGCTGGGAGG GATTGGGGGCAGGAAGAGAAGGGGACAACAGAGGATGAGATGGCTGGATG GCATCACTGACTCGATGGACGTGAATCTGAGTGAACTCCAGGAGTTGGTG ATGGACAGGGAGGCCTGGTGTGCTGTGATTCATGGGGTCGCAAAGAGTCG GACACGACTGAGCAACTGAACTGAACTGAACTGAACTGAACCAGGATCAG ACATTACTTTGTCCACAAAGGTCTGTCTAGTCAAGGCTATGGTTTTTTCA GTAGTCATGTATAGATGTGAGGGTTGCACTAAAAAGAAAGCTGAGCGCCA AAGAATTGATGCTTTTGAACTGTGGTGTTGGAGAAGACTCTTCAGAGTCC CTTTGACTGCAAGGAGATCCAGCCAGTCCATCCTAAAGCAGATCAGTCCT GAGTGTTCATTGGATGGACTGATGTTGGAGCTGAAACTCCAATACTTTGG CCACCTGATGGGAAGAACTGACTCATTTGAAAAGACCCTGATGCTGGGAA AGATTGAGGGCAGGAGAACGGGGACGACAGAGGATGAGATGATTGGATGG CATCACCGACTCAATGGACATGGGTTTGGGTGGACTCTGGGAGTTGGAGA CGGACAGGGAGGCCTGCCGTGCTGCAGTTCATGGGGTCACAAAGAGTCGA ATATGACTGAGCAACTGAACTGAACTGAACCAGGATCAGAATGCTGAAGT ATCTTAACAACTGGTACTAGCATAGTGATGCTTGCAGCTCAGCACTAAAT CTGCTGCAATGAAAGATCTGGGGCTAGAATCCAGACTATCTGAACTTGCT AGCCTGGCTTTTCCATTAATTTACTCTATGACAAAATCAGAATACTTGGG TTTTTCATCTGGAGCCCTGATTTCAGTACATGGATTAGCTTCAGAGAGTC TCTGAGCACACAGAAATTCTGCTCAAAATTTTGACTGCATGGTGTTTTCA TGAAGAGAAGAATCTATAAAACTTTCACCAGATTGTCAAAGGAGTCCATG ACACAAACACAAAAAGAATAAGTGAACTAGAGGTGCCTTTAGGGTTTCTT TTGGTTCTAGCATTCGTCTAATGTGATTCTAAGAGTTCACAGTGTGACTT TTTTTAGTTGCTTTTTTTTTTTTTTTTGAGGGTTGCTTTGTGCTTTCCAC TTTCACTGTGGAAAGTACTTTATATATTCATGTAATTCATTTAAATACAA AATAACCCTTCCATGTTCAATATTACCATTTTTCAGATTCGGAGCTGAAG TTTTTAATAGCTGTTTGTGAGGTTATTTTTTAATGTCTGCCTCTCCCATT GACCAGGAGCTCTATGAGAGCAGGGAATAAATTTGTTTTGACCACTGCTG TAGCCTAACACCAGGCATAGCACCTTGTATATAGTAGACCCTAAATTAAT GCTTGTTGAATAACTTACCACAGATTAAGTGTATAGCTAGGAATGAAACC CTTATCATTTGATTATAGAATTCAGTCTCCTGCCAATACTGCCTCAAGAG TCAGACTTAAGCTATGTGGATTGGGTACATTTCAGTCTTAAGGTTGGTAT TTTCTTAGATGATCTGTGGATTTCACCACCAAAGTCACTTAAGATGCTTG TTAAAAATACATTCCTAAACCCCATTCCATACCTACTGCTACCAGATCAG GGCATTTTGAGAACCCACTAGCTTAGGGAATAGTAAAACTAAAATGTAGT AGTCTCTTCAAAAGGTAAGGCAACTTAGTTACCATATATAATACTTTCTT TTGACTCCTTATATGCCTATTGACATCATCAAATAAAAAAATGTGTTTTC TCAATGAATAATTCAGTTGGGTTTTATTAAATATTTTTTTAAGGTTCAAG CAACAGTAGTTGGCTTCCTAGCAGCTGTGGCAGCAATTATATTGGGCTGG ATTCCAGAGGGAAAATACTATCTTGATCATTCCATACTTCTGTGCTCTAG CAGTGTAGCAACTGCCTTCATTGCATCGCTCCTGCAGGGTAAGTAAATTT CAGTGTCTACTCTGCAGTCTCTACTTTCTAATTATTCATTTTCCGTGTTA GCTATTTTTACTTAACTGATATTTTTTCATTATTTTAAAAAAACAGAGAA AAGTTATCTACAACTTTTCAAATAGCTTATTTCAGATATATTTATATGTA TCACATGTAAACCTTAGCATACAGAGCAAGCTTCCTAAGGTTGTGTCCAG GCTTTAGGTCCCCTGGTACAGCTCCCAAACAAGACCAGGAAAACAGCCTA GAGATTTTATTTGTCTCTGTAAGTTAAATTAATTGAGAAGCTCCTTTCTG GAAATCATGCAGAAGATTTGCTAGCTTGTCATTTGAGTAACAAGTATTCC AGGAATTCTAGATTTCAAAAGCTGTCCCTCTGTTAAAATTTTTTGAAGTT TCAGATTTCAGAAAAAATTCCTTTACTGTCTGTGGCAGTAGAAGTATAAC CATATGCTTAACATAGCATATTGTTGGCTATAGAATGTTAAATAGCCAGA AGGTTTTTTAGTTGGGACACCATTTTTATATTGATTTATTTATATGAACT TCACACTAGAGAACTAGATTATGGAATCATAATCATAAAGACTTGTTAAT TTTTATTTATAATTGCCATCTTCTCATTTTATATCACCAGCAAGGTTAAA AACGGAATACTCTCATATCAGGTGATCTCATACAACGAAGGTAACTTTTG GGGCTAGATTCTGATAATTTGGTGGCTCAGACTGTAAAGAGTCTGCCCGC AATGCAGGAGACCCGGGTTCGATCCCTGGGTTGGGAAGATTCCCCTGGAG AAGGAAATGGCAACCCTCTGCAGTATTCTTGCCTAGAAAATACTGTGGGT GGAGGAGCCTGGCAGGCTACAGTCCATGGGGTTGGAAAGAGTCAGACACA ACTGAGCGACTTCACTTTCTTTCTTTTCTAATAATTTAGAAGCTCTTAAC TTTAAAATTCAGATTTAAAAAATGTATGTCTACACCTTTATTTTGAATAA TGTATATTCCAATTTTTTAGTAACTTGACCTTTATATATGTAGAGCAGAT GGTATTGAACCACCTTTTGTAGGTGAGAAAACTGACTTAGGTAAGTAGGC GTATATAATTTCATAAGCTTATGAACATAAAAATCAGATTTAAAACCTGT TTCTTGACTCCCAACTCTTTTCAGTGGTCCCTGATGGCAAAATAACTTGT TTTCAGCTGAAAAGTTAAATAGCATTCTGTCATAGGAGAACTTTCCACAT TGATTTTTAAATGTACTAATTTTGAAAAAAAAATTATATGATTACATCTT GAATAATTATTGTAATATACATTTAAATGTTTTCCTGCTATGTTTTTTTT TTCTATTTACAATGATATTATGGGAAAGGTAGGTCCATAGATTGAAAAAG CCTCCAGAATATAAGATGTGAGGCATTGAACCAAGACAAAATTTATACTT TTAATAATTTCGGCCTTACGGGTAGTAGGAAAAACACTGTTACAAGCTGT GTGACCTTAAGCAAGGATTTAATTTATGCTTAGCATGTAAATTAACTAAT CTTAAATTTTCTCTGTACTGCATCCTCTTAACATGTTGGCATGAGAAAAT CTGTCCAGTATGGTGTAGATATGATGTTACCATTTTTCTCCCATTTCTCT ATTCGAGAATATGAGGATTTAAATGTACAAGAACCCAGTCACATTTTCAT CTTCTGTTGTTGTAGGTTTATAGACAGAAAACTATAAAAGTTTCTATAGA TAGAAACTTTGGGGTTTAAGAATATCCTGTACAAACACTGCTTCTTGTAT TCTGACCTCCAGTGTTCAAAATTTAATTACTCTTCTCTTCCTAATACTTC AACACTTTTTAATAAAAAATGGGGCAAGCATTTCTGGCTACCTCTGTGTA AACACATCTGGTTTTGTTGGCCTCCTTCTCAGTTGCTATATGTGTAAATA TAACTCACCTTTCTTTGACATTTTCATACTTTATTTGAGGGTTAAAATAA AATCTTTGGCTTTGTACACATGAATACATTACATCCAAGACATGCATGTT ACTAAATTGGAAACTTTAATGTTATTTTACAGTAGCCTTTCAGGTCTCTA AATGCAACACTGAACGTCTCACATCTTTTATGATCCCTACTTGGAATTTG TTGAAAGACACTTTACCAAAACATTCAAGTAAAGTGTTTTGTTTGCTTTA GTCAGCTTATCTAAGCAGCCTAACGGGAACTGATGCGCTGTTTGTCTAGT GTGTGTACTTCAGTGTTTAGGGGAATGGATTTTCTTTAAACCATAGCACA AAAAATAATTAACTTTTTTTTCCCCTAGGAATAATAATGGTTGGGGTTAT CGTTGGCTCAAAGAAGACTGGTATAAATCCTGATAATGTTGCTACACCCA TTGCTGCTAGTTTTGGTGACCTTATAACTCTTGCCATATTAGCTTGGATA AGTCAGGGTTTGTACTCCTGTCTTGGTAAGTTGACCTGAAATTAAATATA ATGCGTTATTCAGAGTCTCTTTAAATAAATATTGTTGCAGCAATATCATG ACTCACAGTGGCCTTCATCTGTGTTGGAACTGTGGTTGAGGCTGATTAGA ACAATCACTGCTACTTGCTGTACACCTACTATATGTTGAGGTTATCACAT ACTTCTTCTCTTCATAAAGAATCTAACACTCTAAAAGATAAGGAGTATCA TCTCTGATTTCAGATGAGAAAACTGAGGGTCATAGAGGTTATGTGAAGGT TGAATGCAAGTCTATCATAGTCTTTGAATTCTCTCCTCTGAATGTGTAGC GCTGAGGCATCAACCCACAGGATTCTGAAACATGTTGCACTGTTGTCTCA GAGCATAAGGTTGTGCTTGAAATTTAGTGATTTTCCCCCATATCAGAAAC CAGTGTGGCAATTAATAATAGCAGCTGAAAAATCACCATGAAAATTAGCC TGAGTGTTGTGGGTATTTGAAGTTATATATGCAATTCCTGATAATAGTTA TTGGGTATTTATAGAATCTAATGAATTGTTTTAATGCAAATTTATACTCC GGAACTATTGTCAATGTAAATGTATATGATTTGTGAACATACATTTAGTC CTAAAAGTTGATTGTAGTTTCATTTTTTTAGATGCCAAATTTTTAAAAAA ATTTAAAGAAAATATAAAACCACAGTAATACAAAAAGAGAGAAAGGTAGT TTATCAGCCAAACCAGAAGCAAACATATATTCACATATCCTCATATATTT TCATGGATTCTAGACAGATTTATGGTATACTTTAGAATAAGTCTAAAAGT ACATTTGGTTTGAAGAAGTCAGAATCTCAGATAAATGTTTTTGAACTAAA GAAAGAGCTTTAACCTAACCAAGGCAGTGATTTTCTGCTACCTTTGGGGA TATCAAGAGAAGCTTCATTTAGGATATAAAATTACCTTACATTATATAAT GAGTGATATAAAAAGCAGTACTCATTAAGACGATGTATATATTCAAGGAA AATCTCTTTGGAATGAGAACTACTGCATCATCACTC project fbnq AF 20040903 10874bp TGTTTTTTTTTGGCATTTTTTAGAAAAAAAAAATTTTTTTTTTTTTGGAA AAAAAAAAAAAAAAAATTTTTTTTGTTTTTTTTTTAATAAAAATTTTTCT TTTTTTTTGGGTTTTAAAAGGGAATAAAAAAGACCAGACCCTAAAAAATC CCCATTTCCCGTTTTTTTAAAAAGGGGCATTTCACCAGGTGTGAAAGAGG GACAGAATTTTGATTTTTTCACCCCACCGGAGGGATTGGGAGTTTTGTTT TGGGTGTCCAGTAACCCTGATCATGGATTTTTTTCATTTATACCCCTTTT TAAACAGTCTAAGAATTATTTATTTTTTTATTTGTCTCTCTATATTTTGT TACTTTGTTTGAGCACTTATATAAATGTACTTCATGTATTTTTTTAACTA TTCAGCTCTGTTTCTGGCTGCTGTTATCTACTGTAATTACTTTTAAGAAT GAATATTTATGATGAATTTAGATGGGTCACTATACCTATATACATACAGA AGTACAATTCCACATGGAGCTGTATATGTGAGAAAAATCTCAGAATTTGC AAGCTCATGGTGAGAAATTCAGCGTTCCTTAGGCGGGAGAAGAAATAGGT ACAGTTTCCTACATGTGTCTTCTCATAGTGTAGTGTGAATGAGAAGTACT GAATTTTAGGCTCACAATTTTCGTGTTAAAATGGTTTCTTTTTCTTTACT ATATTACCAGAAGTTTACTGTAAGTATTGATTTTCCATCATCAAAACTCT TTGGATTTTATGGCATAATATTAATCTCAAGAAAAAGTTGTATATCTCTC TATAAAAATAGTCTATAACCTATGTTTTCTTACCTTGAAATAGACGATAT GCAAAGTATCCTATGCGTCTTTGGTGGATGTTGATAAAGCAGTAGCAGCA GCAAAAGATGCTTTTGAAAACGGTGAATGGGGAAGAATGAATGCACGAGA CAGAGGAAGATTGATGTATCGGTATGATTTTTTTAAGAGTACGAGTCTGA GGACTTCCCTGGTGGTCCAGTGGCTAAGATTTCACGCTCCCAATGCAGAG GGCCCAGGTTTGATCCCTGGTCAGGGAACTAGATCCCACATGCTACAACT GAAGATCCTGTATGCTGCAGCTAAGACCTGGTGCAGCCAAATAAATAAAA ATTTAAAAAAAAAAAAAAAAAAGAGCACAAGTCTGTGGCCTTTGGATACT GACTAACATTGCCAAGATTTAAAAAAATTTTTCAAGACTTTCTATTATGC ACCTATTAGATAGTATATCTTTTGTTACTTCCATCATATAAACTCCCATA TATGGGAGTTCCTGATTTTTGTATTTTTGCTTGTTTCAGTCATCATCCCT GTATGAGCAGTTTAGTAAAGGACTACTTATTTGTAAAGATGTAAGCAAGG TCAAGGGAATCCAGCTTGTTTCAGTCATCATCCCTGTATGAGCAGTTTAG TAAAGGACTACTTATTTGTAAAGATGTAAGCAAGGTCAAGGGAATTCATT ATCAAGGATAATGAAGCACTCAGGCTGGAGGGGTAAAACAGGGAAACTGC TCTTACTGCAAGGCCTAATGGGACAGAGGAAGGGGCTGTTACTAGAATCT GGCAAGATCTGTGGCTGCAGGAGGAGACCACACCCGTGGGTTTCAGTGGA AGGACACAGCAGCTACCGCTGCCCATCCACAGCCTACCAGTCAGCCATCC CCAGACCACTTTATCCTCCAGTTTGGCAGTCTCCTGGGGCTGCCTCCCAC TGGCCTGTCATTAGCCAAGTCCAGTGAGAGAACCCAGAAGCCTGTGATGT ACTCTGTAAAAGTCATCCTCCAGGGGTCACAGAGCAGGGCGGAGACTGGA TTACAAGCAGCACATGGAGAACATCCAGCACCCTGCTGTTTCCACGGAGA AATTTTAAATCTACTTGATGTGTGAGGAGTAGAAACAAGGAGGAAAAACA TGAAGGCTTGGAAAGGGTGTTATAAATTGGTAGCTGAGTATGCCAAGCGT AATTAGATTCAATCCCAGATTCAGTTTTCTGCTTACTAAATGACAAATAG CTGATCTTGCTCAAAAGATCTCCTAGAGCAGGATCTGGAAGAAATATTAG GGAGGAAGGTTCCAAGCCTGACCTGGAATGGTCTGAAAGAAACGGGTCAG AACCATGAAAGGAAGGAAGGAAGGAAAACAAATGGAAGAGGTAGACACAA AAGATGAATTTTGACTATTTCATAGTCATTAGTCAGTTTCTAGGTATCTT TCCACAGAAACCAGACAAACAGAAGCCTGTTGTGGTGTTTATAGTTCATT CCATGTATTTCTGTCTTGTCCTTTTCAGCCAGTGTTGGAAATATTTCTAC ACCAACCAGAAATCCTCAGGTGTTCGTGGGTTCTCCAGGGGTGTGGGTCG CCCTCTAACATCTCCCAGTGTATTCAGGAACTATCCACGTTCCCACTGTG TTCTGTCACTGATCTCCTTGGCTGACTGTGACTCCATCACTCTTACTTCT TATGCGTCTATAATGCGAATGATACAGACTTCCAACACCCTCTGCCTCTT CATGATAACTCTTAAATTGTTCATGCAATTATTAGTTCAATGCCTGTCTT CCCTATGAGACCACGTTCTCCATGAGGACGGGGACCTGGTCCATTTGTGT GAATTCTCAGCCCTTAGGAGGACGCCTTTTACACAGTAGAGACTCAATAT CTGTTGAATGGATTTCTTTCACTGGCCAACAGACTTGCAGACCTAATGGA AGAGAAACAAGAAGAACTGGCAACCATCGAAGCCCTCGATTCAGGGGCTG TCTACACCTTGGCTCTGAAGACTCACATTGGAATGTCTGTGCAAACATTC AGATACTTTGCTGGCTGGTGTGACAAAATTCAGGTAAGTGCAAAATGTTG TTTGTTTCCGTGGAGATCATTCCTAGAGGAAAATGGACGAATGTTTGTTA GTTTATAAAGACCCCTTGTCAGAGTCACCACTTCCGTAGGTTTTCTCATC TGATCCTCATAACAGTTATCTGAGGTAGGTAGATAGTTGTCAACTCTTAT TACAGGTGAAGAAACTGAGGCTTGAGGACAATGAATGACTTACCTATGGT CACATAGTAAGCAGAGCTAGGATTTGAACTCAAGATTTTTCTGAGCTTGA AATCTAATATTGTTCTTTGTTTTGTACTATAATATCTCTTGAGAGCATCT AATAGTCTTGTTGGCATATAGACAGAAGCTTGATATAATGGAGGAATTGA AGACTCAAATACCTAAGGAGGTCAGAGAGCTAACATAGTTGGGCTATGCA GACTGGTTATAAGAAAAATTTCTTAAAAACATAAATTTGATAAAAATGTC AATTTCCTTCTTCTTACAAGAAAATAAATAGCACATGTGTGATGATAAAT GGCAACTACACTTGGCTTTGGTATTGAGATATAGAAGAGAAATAGGGCTT GCAGCAAACAGCAGAATGCATGCCACTTCTGGTCTCATGGTAACCACTGA AGCACCAGCCATCACAGCCACATTCCTAAAAGCCAGGAGTAAGTGGGAAA GAGGGAGAAAGGTAAAAGGACTTTAAGAAACATTCCCATCCTCCCTACAC TTTGTGTTTGTATCTCCCATTGGCTGTCTCTATCTGCTAAGGATACTGGG AAAGTTTTTTCTGGTCACATTGCTGTACCATCATTTTTATAGAATCAGAG AGACCACCTGGTTCCAGGCCTCATCCTTGCCACTTACTAGCAGTTGTTGT TATTTACCTCTCTCAGCCTTACTTTCCTCATCTGTAAAATGGTCATGATA ATCCATACCTTGCAAACTATGTTATGAGAATTAGAAATGAGTGTTTATAT ACTACAAGTGTTTATATATACAGAATTAAAGTCTGTACTATAGTAGGTCT TGCACATAAGTGTAGTTTTTATTATTGTTCAGCTACAAAGTCATAAGTAT TTAGTAAGAGCAATTTAAGTCCATCCTTTATTCTCAATTATGAAATCCAA ATAGTTCTGAAACCTGAAAATTGATTTGTTTGATTGACTCAAACTCATTT GGTGCCAAAATCTTACCCAAACCAACATGAGTCTATAAGTTTTATTCATC TTCAGTTCAGTTCAGTTCAGTTCAGTTCAGTCTCTCAGTTGTGTCCGACT CTTCGTGACCCCATGAATCGCAGCACGCCAGGCCTCCCTGTCCATCATCA ACTCCCGGAGTTCACTCAGACTCACGTCCATCGAGTCAGTGATGCCATCC AGCCATCTCATCCTCTGTTGTCCCCTTCTCCTCCTGCCCCTAATCCCTCC CAGCATCAGAGTCTTTTCCAATGAGTCAACTCTTTGCATGAGGTGGCCAA AGTACTGGAGTTTCAGCTTCAGCATCATTCCTTCCAAAGAAATCCCAGGG CTGATCTCTTTCAGAATGGACTGGTTGGATCTCCTTGCGATCCAAGGGAC TCTCAAGAGTCTTCTCCAACACCACAGTTCAAAAGCATCAATTCTTCGGT GCTCAGCCTTCTTCACAGTCCAACTCTCACATCCATACATGACCACAGGA AAAACCATAGCCTTGACTAGATGGACCTTTGTTGGCAAAGTAATGTCTCT GCTTTTGAATATGCTATCTATGTTGGTCATAACTTTCCTTCCAAAGAGTA AGCGTCTTTTAATTTCATGGCTGCAGTCACCATCTGCAGTGATTTTGGAG CCCAAAAAAATAAAGTCTGACACTGTTTCCATTGTTTCCCCATCTATTTC CCATGAAGTGATGGGACCGTATGCCATGATCTTCGTTTTCTGAATGTTGA GCTTTAAGCCAACTTCTTCATTCTCCACTTTCACTTTCATCAAGAGGCTT TTTAGTTCCTCTTCACTTTCTGCCATAAGGGTGGTGTCATCTGCATACCT GAGGTTATTGGTATTTCTCCCGGCAATCTTGACTCCAGCTTTAGAGTGAA TACTCATAGTTCACTGAATAAGTGTTCAGTGGGTTGCCTTTCCCTTCTCC AGGGGATCTTCCCAATCCAAGGATCGAACCTAGGTCTCCTGCATTGTAGG TAGATTCTTTACCATCTGAATCACCAGAGAAGCCCAAGATGACTGGAGTG GGTAGCCTATTCCTTCTCCAGAGGATCTTCCTGACCAAGGAATCAAACCA GGGTCTCCTGCATTGCAGGTGGATTCTTTACTAGCTGAGCTACCAGGAAA GCCCTGGATAAATACTAATATGCTTGATTATGGGAGGCAACCCCAAACAT TAATGGGGGTTATAGATATTATAACATTATATAAGGTATTGTTTATGCAT TATATTATGTTTCTAAAGTCAAATTCTGAATCCCAAAGCACACCTGACCC TAGGGTTTCAGATGAGAGATTATACACTTGTATTAGTAACAGCAATAATA TTTTATGTGGCAAAACAGATGGATAGTTTCAGTTAAAGATTACTGCCAAA AATCAGTTGGGATCAAATTTAGCTGCATATAATAGAAAACCCAACCAAAG AGTCTTTTTATCTCACTTTCAAGGAGTCCAAGAGCAGGCAATCAAGACTA GTCTGAGACAGGAAGATTCCTTCTCTCTCTTTGCCAGGCCATCCTTAGTA CCATGTGACTGCTACCGTCACGGCTGCCTCTTGGTGTCATGATAGCCACT GCAGCACCAGCCTTTTTAGCAACATTCTGGAAGGAAGAATGAAGAAGTGA GGGAATAGGTAAAACAGCACTTGTTTTAGCTGAGTCAGCCTACTTTAAAG AGTGTTCCCCTTCCAGTGCATTGTACTTATATCTTCCATTAATCATCACC ATTTGCTATGGAAACTGGGGAACATAGTACTTTACCTGGCACATTGCCAT CCCCATTATTAACCAAGGGTTTCTGTTACTAAGAACAGAGGGGAGAATAG ATATTGGGCAGGCAATTAACATTCTCTGCCATGCCCAGAAATTGGGAATG GAGATGATCAAATTAGAATTATGTGTTTTTTTTCTCCTGTGTCTTAGTTC TTTTGAGAAGGGCATAGCAGTTCCTTTTTAGGTGTGGCTATGTTTCTTAT AAATTGAACACTGCTTCTTTTCTCAAACTGTTGATTTTGTATTGGGATAT AGCTGATTACCAATGTTGTGGTAGTTTCAGGTGAACAGCTAAAGGACTCA GCCATGTACAGGTATCCATTCTCCCCCAAATTCCCCTCCTATCCAGGCTG ACACATAACATTGAATAGAGTTCCATGTGAACACTGCTTTTTTTAATATC AGCTAAGAGAAAGTAAGAGAGGCAGATAGAAAATGGATTCATTGAGATTA AATTTACTCATTTAAATTAATAAAGTAGGAACTTCCCTGGCAGTCTAGTG GTTAAAACTCCATGCTTCCAGTGCAGTGGGTGCAAGTTTGATCCCTGGTT GGGGAACTGAGATCCCACATGCTGCATGGCAAAGAAAAAAAAAATGAAAT TAGTAAAGTAGTATCAACCTTTTTTATTCTTTAGGGTTCTACAATTCCCA TCAACCAGGCCCGTCCAAACCGCAATCTGACCTTTACCAAGAAGGAGCCA CTTGGGTAAGACAAGGAGAGTGCCTCTGCGTGGCGTGTGTTAAGTTAGTT TGAGGGGACTGAGGCTGTCTCTTTCTCCTCTTGCAGAGTCTGTGCCATTA TCATCCCCTGGAATTACCCGCTGATGATGCTGGCATGGAAGAGTGCCGCG TGTCTGGCAGCAGGCAACACCTTAGTGCTCAAGCCGGCGCAGGTAAGACA CACGAGACCAGGTGTGGCATCTACCCCTCCCACAGACGTATGTTGACAAA TATTATTTCTTGAAAAAAATGGGATCATATATTACACCATCTTTTCATAT ATCCTGGGCATCTTTTCATATTAGTAAATATTCATTTTTAATAGCTACCC AAAATGGGGATTCCAGACTTTAGAACATCCATGAGAATGGAAGCAGCATA GTGTATGTCAGTGAAATCCCCTGAATTTCTACAAACCAGTTCAGTGCTTG CAAAATGCCACATGCCCCGAACTGAGGGAGTTATTTAGAGTAGTTATGAA ATAGCAAAAGAAGTTTTATGCAGGCATTCAAATTTTAATTGTCAAAAATA TTGTAAAGTTATTTACAATAAGATGTGGGAAAAGCATGCAAATAATGTAC ATAATTGTAGCTGTTTGAAATATATATGTATGTGTAAAACAGGAAGTTAG TTTAAAAATAAATGATAGAGTTCTCAAAAACATCTTTTCAATGCTAGAGT AGCTTTTCAAGGAAAAAAAAACGTAGCAAACTTAACACCTGGCTAAGCAT TTCCTCCAGACAGTGCACAGGAGTGGACATTCTGAGGTACCCAAGTTGGT GGGGAAAGCTTGGTCTCTATTCAAGAAGAGTCTACAGTTTGTTACCTATT ATTTTTTTATTTCTTCTTTTAGGATTAAAAATTTTTTTTTCATTTGGAGC AACTATATAGTCATGTGACCACAGCCATCTTGTTTTCCTCATTAAAAAAA AGATATACATTCAAAATTTTTTAAATTAAAAAAATATAAAGAGATAGATG ATGAAAAGTCTCCCTCTTATTCTCCTGGCTAACAAGTTTACCTCCCTGAG GCAACCAGTGTTTTTGTTATTTATTAGTTTCTGAGGTATTCCAGATATAT TCTCTGTGTATACAAGCATATTTTTTAAATTAAATAATTAGGTAATTTTA AAAATATTTTTTAACCAACTGAAAACCACACAGGAGGAGAAGGGTTAATG AGAAATTGCTAATCAAGAGGCATAAAATTTCAATTATGTAAGATGAGTAA GTTCTAGAGGTCTGCTATACATCATATTACTGGACATGAATTTGCACAAA CTCCAGGAAATGGTGGAGAACAGGGAAACCTGGCATGCTGGGAAGTCCAT GGGGTCACAAAGAGTCAGACATGACTTAGCAGTTGAACAACCCTAATGTT GTATTGTACACTAAACAAATTATTAAGAGGGTAGAGGTCATGTTAAGTGT TCTTAGCACAATACAACACAATATAAAAATAAAATGAAGTAAAATAGAAG CACTCTCTACATACTTACCAAAAAGGGAAAAAACTTAAAAAAAAAAAAAG TTTCCAGTGTAAAAAATGTGTTAGTCACTCAGTTGTGTCCGAGTCTTTTC GACCCCATGGACTATAGTCTGCCAGGCTCCTCTATCCATGGAATTCTTCA GGCAAGAATACTGGAGTGGGTTGCCATTTCCTTCTCCAAGGGATTTTCCC AACCCAGGGATAGAACCCTGGTCTCCTTCATTGGAGGCAGATTCTTTACC ATGTGAGCCACTAGGTAAGCCCAGTGTAAAAAATAAACAGTATTTTATTT AACCTATACCTAATTAATGGATATTGAGATTTTCTGCCTTTTTGCTGTTA TAAACTGTGTTACAGTTAATAACCTTTTAAATATAGCATCATGGGTCTTC CCTGGCAGTCCAGTGACTAAGACTCCGAGCTTCCAGTGTAAGGCACGTGG GTTTGATCCCTGGTCAGGGAACTAAGATCCCATATGCAGCACAGCAAAAA AAAATTTTTTTAATTGAAAAAAATATACAGCTTCATGCACATATGCAACT ATCTTTGTAAGATATGTTCCTAATAGCAGAATCACTTAGTTAATAGATCC ATGTTTTGTGTGATAGATATTGGCTCATTCTTTCACAAGGATTGAGTAAT TCACCAGCATCCTGTATGAGTGCTGTTTCTCCCAAGCAGCAGCACTCATT AAACAGCAAAAAACTAGTAAAATGAAGAGAGGAGGCAGATAACTTAGCCC AGCAGTGCTCAATCCTGGCTGCACATTAGAATTGTCTTTTAAATTCTCTC TAGAATTTAAAATTCTAAATTTTAGAATTCTCTTTTAAAAATACTAATAC CTTGGCCCCACTGGCAGAGATTCTGATTTAACTGGTCTGGGTCAGAGGCC AGACCTTGGTATTACTTAACTTCTTCACATTAGTTTCTAAGGTACAGCCA GAGTTGAGAACCACTAGATGGTGGTATCCAAAGACAGTGCTAAGCATTGG AAAACTCCAGTGACTACACGGAATATTCAAAAATTACAAACATGTATCGA GTGCACACTAATTGTCAGGCATATTATCAGTGACAAAGACATGAAATTTC TGTCCCATGGAAATTACTAATTCAGGATAGTTTTTAAAAGTCTTTCTAAT CATGATGATTTCATACTAGAATTTTCTTTAACTATAGTAGATATAAAGCC ACTATTTGAAATATCTTCTTGCCAATTTTAAATATTTGAGCATTTGAAAA ATTTCTCCTCAAGTATAACTAGGTTGACATTTTTTTAAACGTCATAATGT TTATTGCCATGGACCTGTTACTAGAAGGAGGAAAAATGTGAACCCTGTTT TTTTGTTGTTGTTGCTTGTGTTTGTCCTATTAATATTACTGTTTATTATG CAGTTTCTATATAGATTCCTTTTCAGTCTCTTGACCATTTTATTAGCTAA AATAACAATATAGTCTATGAATATGCAAGCAGGCCTGTAAACTCCAACAC ATGGCAATATCCTGAAAGCATAGTGAGCAAGTGAGGAAGCCACAGTCTGT CCCTTGGCCTTGTGAGCTCCTGTTCTTTCCTAGGACACCACACTTACCTG TGATCAGTGATCCTCTGACCTTCATTCAGACAGAGTGAGAGTACCGTTAT CCAGCCCCATATTAACTGTTAGCTATGTTTGATTTATTTCCTGTCTTTCT CTGTTAAAATATAGAAATAGAAGCTCTACTATTTTTCTATTCACAACTCA ATTTTCGTCCATTCCATTTTTTGAGACCAAGCTAACAGAATACTAATTTA AGACTTAATCAGCATTGGTTTTTCAGTGTAAACACATTACTCTCATTTTG CTTCTGAGATATGCATTGCTGTAATAGATCTTTAAGATGAGATCCATAAC TATACCACTCTTTTTGGTAAAAAGAAAGGGAAAATATTATGTGTTCACTG AGCAAAAAGAAACATGGTAAGGATAATGAGACTAATGAGGTTGATTAACT TGGGAGGATGACCTAGGAAGGATGGGGGAAGGGGTTCTCAGGAGAACACG TCTTTGAATGTACTGTTGTATAATCCTCACTTTTGGAAGCATGTTTCCCA TACTCTACAAAACAACAAATGAACAAATAAAGAAAAAAATATAATCAACA TAGCTGAGGCCAACATTGAATACAAAAAAAATCAATTAAGCCAAATTTCA AATTAATAACAGCATCACGCTAAAAGCAATGAGGAAGGACTAACCCAAGA AACTTTTGATTGACATTTGGACTATATGGCCTCAGACTGGAGGCAAAAAC ACTGTAAATAATATTGAAGTTAGTAGGCTTCTTTTTCATAGGCTTAGTAA TTTTCAAAATATTTTCTGTATATTTTAAGACTAAGCAAATAAGTAAAATA TATTGTGGATGTTGAGATTATATCATACTCCTTAAACAGTTCAAAAACAC AGAGAGAGAGGAAGAGGATAAAGCAAACAGTAAAATATTAACATTTGAAG AATGTGGGTGACAGATACATAGGAATTCTTTGTACTGTTTTTTGCAACTT TGCTATAAGTCAGAAATTACGTAAAAATAAGAGAAAAAATAAACTCTAGT AAAAAACAACAACACTAGTGTGGCCATAAAAGGATAGCTGGGTATTGGTC CACAGGACAGGACAGAGTCTGAAGGCAATTTCTGTCTACTTCTGCTCAGG TCACGCCCTTGACTGCTTTGAAGTTTGCTGAGCTCTCTGTTAAAGCAGGC TTTCCGAAGGGGGTAATCAACATCATTCCAGGCTCAGGTAAGCAGTGATG AACTACTGTCATCATCAGTTGCCC project fbnq AG 20040903 9304bp GGGCCCGATGGTCGTAGTTCTCATATGGGTCCAGGTTCATCACTGGGTTG GAAGATCCCCTGGAGTAGGAAATGGCAAACCACTCCAGGATTCTTGCCCA GAAAACCCTACCTTCAAAGGAGCCTATGGGACTGTAGCCCCCCAGTCCCC CATCACTCTTTGTGATGGAATCTCAAAGAGTCGGACTCGACTGAGCAACT GAGCACAGGACACAGCAGCAGCAGCATCACCTGGATGGTTACGAGAAACG CAGGATCTCAGTTCCCAAGCATAACCCAACCTACTGAATCACAACCTTGC TTATAGTATTAATACCATCTCCATGTGCTTTGCTTCCCTGGTAGTTCAGT CGGTAAAGAATCTGACAACAATTTGGAAGACCTGGGTTCAATTCCTGGGT TGGGAAGACCCCTTGGAGAAGGGCATGGCAGCCCACTCACTCCAGTATTC TTGCCTGGAGAATGCCGTGGACAGAGGAGCCTGGCAGGCTACAGTCCACG GGTTCTCAAAGAGTAGGACACGACTGAATGACTAAAATACAAACCATGTG CTGTATGTAAACATGGAAGTTTAAGAAGCACCTCCCTGAACATCCAAGAG AATTTGATTTATACACATTAGACTAAAAATTAGATGTTGTCACACTTTCA GATGTGACCAAAGACCTAAGTACTGGTAACACATACACCACCACTAGTGG GAGTGGAAACTGCACAACCACTTTGGAAAACAACGTGGTCTGATCTACTA AAACTGAAGACATGTACGTGCCACATACCAACAATTCCACACCTAAGTCC ATACCCTGAAGCAACTCTTGCTTTGTACACAGAAGACACATAAAAAAATA TCCTTAGCAACATTTTCACATTAGCAAAAAAAAGAAAAGAAAAAACTAGA ATTAACACAGTAAAAGATAAATCGTGGGATATTCACACAATGGAATCTAT GAAGGAGGGGATTATAAGCAAGCACAAATTTCAAGAGAATGCTTACATTT GTGAAAGTAGTACAAAAACCACCCAGGGAGCTCCAAAGGTAGTGGTTATA TTTTTAAGGCTGGGTAGTAGATACCTAAATGTTTATTATTGTTCTTTAGT TCAGTTCAGTCACTCAGTTGTATCTGAATCTTTGTGACCCCATGGACTGC AGCACGCCAGGCTTCCCTGTTCATTACCAACTCCCGGAGCTTGCTCAAAC TCATGTCCATTGAGTCGCTGATGCTATCCAACCATCTCATCCTCTATCGA TCCCTTCTCCTGCCTTCAATCTTTCCCAGCATCAGGGTCTTTTCCAATAA GGCAGTTTTTCGCATCAGGTAGCCAAAGTACTGGAGTTTCAGCTTCAGCA TCAGTCCTTCCAATGAATATTCAGGACTGATTTCCTTTAGGATTGACTGG TTTGATCTCCCTGCCGTCCAAGGGACTCTTAAGAGTCTTCTCCAACACCA CAGTTCAAAAGCATCAATTCTTCAGCGCTCAGCTTTCTTTATAGTCCAAC TCTCACATCCATACCTGACTACTGTATGGATGTAGTACATAGCTACATGC AAAAAACCATAGCTTTGATGAGACAGATCTTTGTTGGCAAGTAATATCTC TACTTTTTAATATGCTGTCTAGGTTGGTCATAGCTTTTCTTCCAAGGAGC AAGCGTTTAATTTCATGGCTACAGTCACCATCTGCAGTGATTTTGAAGCC ACATAAAATAAAGTCTCTCACTGTTTCCACTGTTCCCCCATCTATTTGCC ATGAAGTGATGGGACTGGATGCCATGATCTTAGTTTTCTGAATGTTGAGT TTTAAGCCAACTTTTTCACTCTCCTCTTTCACTTTCATCAAGAGGTTCTT TAGTTCATCTTCGCTTTCTGCCATAAGGGTAATGTCATCTGCATATCTGA GGTTATTGATATTTCTCCCAGCAATCTTGATTCCAGCTTGTGCTTCACCC AGCCTGGCACTTCTCATGATGTACTCTGCATATAAGTTAAATAAGCAGGG TGACAATATACAGCCTTGAATCCTCCTTTCCCGATTTGGAACCAGTCTGT TGTTCCATGTCCAGTTCTAACTGTTGCTTCTTGACCTGCATAAAGGTTTC TTATCTCTTTAAGAATTTTCCACAGTTTGTTGTGATCCACACAGTCAAAG GCTTTGGCATAGTCAGTAAAGCAGATGTTTTTCTGGAACTCTCTTGCTTT TTCGATGATCCAATAGATGTTGGCAATTTGATCTCTGGTTCCTCTGACTT TTCTAAAACCAGCTTGAACATCAGGAAGTTCACAGTTCACGTACTGTTGA AGTCTGGCTTGGAGAATTTTGACGATTACTTTGCTAATGTGTGAGATGGG TGCAATAGTGCAGTAGTTTGAACATTCTTTGGCATTGCCCTTCTTGGGAT TGGAATGAAAACTGATCTTTTCCAGTACTGTGGCCTCTGGTGAGTTTTCC AAATTTGCTGGCATATTGAGTACAGCACTTTCACAGCATCATCTTTTAGG ATTTTAAATAGCTCCACTGGAATTCCATCACCTCCACTAGCTTTGTTCGT AGTGTTGCTTCCTAAGGCCCACTTGACTTCACATTCCAGGATGTCTGGCT CTAGGTGGGTGATCACACCATCGTGATTATCTGGATTGTGAAGATCTTTT TTGTATAGTTCTTCTGTGTATTCTTGCCACCTCTTCTTAATATCTTCTGT TTCTGTTAGGTCCATACCATTTCTGTCCTTTACTGTGCCCATCTTTGCAT GAAATGTTCCCTTGGTATCTCTAATTTTCTTGAAGCAGTCTCTAGTCTTT CCCATTCTATTGTTTTCCTCTATTTCTTTGCATTGATCACCAAGGAAGGC TTTCTTATCTCTCCTTGCTATTCTTTGGAACTCTGCATTCAAATTTAACA TTTTGATTATTTGGCATGTGTGCTTCGGTCTGAATGATTCTGTGACAGAT TTTATTACTCCCCATTATTGCTTCAGTCCTGTAAGAGGACTGTCATCTCT GCCTGTTGCCAAATTACCTGCAGGGAGTATGTGAAGATTACACTGCCTCA TCTCTACTGACATCAAGTCTGGGCAGACGACTCAGGAAGCAACAACATCT ACAAACAGAAGCAGTTCAACTCTGCCATCTTTTCCCTCCGTCATGGGAAC GACATGTCCAAGGTTCAGACTGGGTCCTGGGACAAAGATAACACCCAGAG CTGCAGGTACTGAAGCTCATCTGCAGCAACCTACGGGCAACATGTAGGAG GAGAGAAAGAAAGCTTTGCTGCTGAAAGCCACCGAGGGTTCAGGATTGTT TACTACCACAGCAAGATTTAATGAAAACTAAACTCAAAAGCAGGCATCTT AAAAAAGAATCTGACCCAAATATTCCCATCTATTTTAGTTTAATAGAGTC TCTCTGATATACTGAGCATGTAAGGATTCCATCTATGGTTAAAGAGCTTT AAAAGAGTGTTTTCCAAATATTTAGATCTCGTTAACCACATTTCCCCTCA AATTTTATCAAGTTAACAATGATTTTTCCTTTAAAATATAAGTGCACATT TTAACACCAAACAAGTAGAAAGGACAGACTCTTAGACTAAAAGCCTTTCC ATCGAATACATTTAGATTTATTAAGAACTCACTCCTTGCTTTCTGTGGAA GCTCTGTCATGGGCCAACATTAATCAGAGAGTTGTGTTAGGGAACCACTG ACTTAAAGGAAAACAAACTAATATCAGACAGTCCTGACTAATTCAACTGC AGTTACAAAAATAATAATAATGTTAAAATCGCTTGTTTTTAAAAGTTAAG AAAAAGAATTGTATGTGTGCTGATTTACTAAATCAGTATCTTGGAGAAAA TCTGCCCATTGTGCTGTAGGAGGCAATCTGTTCCTTTGTAAAGGTTAAAT AATACACTTGAAAAATTCATCAGAGCAGCTGAGTTAGCAGACTTATGTCA CGCCTCATTACTAAGAAAGGCAATAAATGTAAGTTTAATACTTTATCTTC CCATTAGAACAAAAAGATGAAAGGAGACAAAAATCTCAAAACTTGTCACA GCACTGTCACACACATATACTCACACCAAATGACCTAGAAGTCAAGGCAG ATTATGGTTATTATGTATTCTTAGTTTTGCCACTCTCCAAGTGTGCATTC TGCTTTTCACTTCCTCTGAATATATGTATTCTGCATCTCTGTTTGTTAGA AGATGCAGATAGTCACCAAACAGGATGTATTATGTGGTCAGTTAAGTTAG ATTTCAGAGACGTCATGCCAGACAAAATGAGACCTTAGCTGATGTTGTAC AAATTATTTTCTTATTTAAAAAAAATTTTTGGCACACTTTTTTCAACGAT ACCCAGTAAGTACTGACTTGTTTCACTGGATAGCACGTTCACAAAGAAGG ATTATATCTATTTATAATAATTTGCTTTTTTGTAGCACCCAAACAGCAGG CTGCCTTCATGGCTGATCCGTTTTCTTTCACTATTTCCATTTAAAGAATA AAACCTATGTAAACATAAATCCTCATTGATTTCAATGATTACTATTTCCA TTTAAGCAAAAACTATTTTTAAAACTCTCAATAGTCTTTTTGATACCCAG TTTGGTCACCTGAATTCCTTAGCTTCTCCATTTCTTATCCCCAAACTCCA TTTTCCTGAAGAATTGACCATCAAATCACTTTTCTCAACACGTATCCCAG ACAGCTCTTAAACAATCCCCTCTTTGGTTTTCTCATGTTCACTCTGATGC CAGCTTTCTGCTGTCCTACCATAAGCTCACTGTCAAACCCTTCTTCCTGG AGAACACATCAGAACCCACAAGGTCACCCTAGTCCCAAGCATGGCTATCA CAGCCTTGACTACTAAATCATACTGAAGAGCTCTATTCCTCATTTGAGCT AGTCCAACAGCTACTACTAAAATCAAATCTCATAAAAAAAAAATTTTTTT TTTTTTGGCAGTGCTATCAGCATGCAGGATCTTGTTTCTGTACTAGGGAT CGAATCCAGGCCCCCTGCATTAGGGGTGTGGAGTTTTAACCACTGGACTG CCAGGAAAGGCCCATCATTTCTCATTTTAAACCCTTTGATTTCACTATTC TCATCCACAGGGGTCCTAATTGTTTCAAACTAATTTTTTCTACTCAATTT CCTAAATCAGCTAAATTATTATCTCTTATTCTTCTTTAAGCTTTCTCTAT TCAACCAAATTTCTTTTATTCAGTTGTCCCTATACTTTCTACTAACTGTT TCTAATGTTCTGGAACTTTGGCCTCATTCAAAAGGTCACCATAAAAATTG ACCACCTCAGAGAAATCTACCTAAATTAATGCCAGAGTTCAGGGTACAGA CAGAAAAAAAAAAAAAAAAACACAGTCAAAATTAAATGTCCAAAACAGTG AGCAATCTTCCTATCATGTACAGTTTTAAAAGAATTTTTTAAAAATAAAA GGTATCCATTTGGTTTCCCATTGCCAATTCCTACAGGGCAAAGAGAACAT CTTCTTTTTCTGATGATACTTGCTATATCACTTGACCCTCAAAAGTTAAA AATAAATATGGCAATGAAAAAGAAATCTCCAGAACTCCAAATGTACCAAT ATTACTGCTGCTTGGCAGAGGTATATATAATTCATAGTATCCAGTTGGTT TTTCCAGTAGTCACGTATGGATGTGAGAGTTGGATAATAAAAGAAGGCTG AGCACCAAAGAATCAATGCTTTCAAATTGTGGTGTTGGAGAAAATTACTG AGATTCCCTTAGACAGCAAGGAGATCAAACCAGTCAGTCCTAAAGGAAAT CAACCCTGAATATTCACTGGAAGGACTGATGCTGAAGCTGAAGCTTCAAT ACTTTGTCCACCTGATACAAAGAACTGACTCACTGGAAAAGACCCAGATG CTGGGAAAGACTGAAGGCAAGAGGAGAAGGGGATGACAGAAGATGAAATG TTTAGATGGCATCACTGACTCAGTGGACCGAGTTTGAGCAAACTCTGGGA GACAGTGAAGGACACTGAAGCCTGGCATGCTCCAGTCTATGGGGCTGCAA AATGTCAGGCACAACCTATGGAGGGAACCACACGACTAGGAAAAAAACAA ATGTATGGATCTGTATTTTGCCCATTTTCTGCAGTTTACCAAGGAAAAGG AACAACCCCAAGGCAACGATTCTAAACAACAAAGGTGCATCTAGTCAGTA ACTATCCCATAAACTCCATGTGGTGTAAGTCTCGAACTGGTCCAAACAAT AGCAATCCACACTATCTTATCTCACGATTTCTATCAATGTTCAGGGCATT TAAAGTACTTGGAAATTGAAATATAAAGCACGCTACCTCACAAATACTGT CCTCCCTGATGAAAAGGCTCACCTCTAAAGTAGGATGAAGTATCTCTCCC CAACTCCTTTTTTGTTTTGGCTCAAATGCACAGTTAGCTCCTGAAAAAAA AAAAAAAAAAGAGTTTTTTAATTTAAACTGGAAACTGTCTACTAAAAGTG AATTCAAGCATTCACACAGGTTTCATTTATGTAATAGGTAGTGATGTCAA ACTTTATTGATCTGGCGGTCCTGAGAGTCTCTAACAAACACAAAAGCTTG AGAAATCATGGGAATGATTCAGCTCCTGCTATCCAAAAGCTAGCTGATTC CATAAAACAATCAGTCATTCTAAGGCTACCCACAGATAGAAAAAAGTAAC AAAGTTTCTACAGGCCTAAAAGACAGCTAAACATTTGTAAAGAATTTGAG TCCAGAGAAACAACCAGTGGGTATAATAAATCCTCTGTATAATAAATGCT CAATACACTTCAAATAATTTTTCAAAGAAAACCAGACCCAGACAAGTGAT TTTGTTTTCAGAATCACAACCCTCAATCCCACTTTAAAAAAAAAAAAAAG TCACTTTTAAAAGAATGCTTTATTTGGAAGAAGGATACATCAAAGACAAG CCAATGAATCAACTAAAACAAAATCCACAGTGGAACCATTTCTGCTTATT GAGAAAATGTTGACAGAATAAATAGAGTGTGCATCCAAAGAACAAAGTGT ATTGCATAAACAAAAGTCTATTCAATCAACTGCCAACAGTTAGATTATAT TTAGCCCTACCAAACCAACTGAAAAGTGAAAAACAAATCATTTTACTAGA TATTTTGGTTAGATTAATAACAATACATAAATATTTTTATAATACGGTAA CTGCGGCTGTGAAATTAAAAGACACTTGCTCTTTAGAAGAAAATCTATGA CAAACCTAGACAGTGTTTTACAAAGCAGAAACATCACTTTACTAACAAAC ATCCATATAGTCAAAGCTATGGTTTTTCCATTAGTCATGTATCGACTTGA GAGCTGGACCATAAACAAGGCTGAGCGCCAAAGAATTGATGCTTCCGAAT TGTGGTGCTGGAAAAGACTCTTGAGAGTCCCTTGGACAGCAAGGAGATCA AACCAGTCAATCCTAAAGGAAATCAACCCTGAATATTCATTGGAAGAACT GATGCTGAAGCTGAAGCTCTAATCTGAAGCCAACTCAATGGAAAAGACCC TGATCCTGGGAAAGATTGAGGGGAGGACAAGAAGGAGGCAGCAGAGGATG AGATGGTTGGATGGCATCACTGACTCAATGGACAAGAGTTTGAGCAAACT CTGAGAGATAGTGAAGGACAGGGAAGCCTGGCATGCTGTAGTCCAGGGGG GGTCTCAAGAGTCAGACTTAACAACAATACAGGTAGTAGGCAATAATCAG AAATATCAGGACTACTGTTTGAAATAATTCAGTTAATGGTCAAATAACAA AGAAGTTAAAGCACAGAAATCTGTTTTGAAGTACAGAAACTGCTTTTAAG CAACAAAAAAAGTATATTTCTCCCACTTTAAAACATTTCTTACATGTATC TTATTTTAAAAAAAACTACCAATTAATGATGCTCTTGCAATTAACTTGCA ATTGACATTCATTAATTTCCTGCACACTATTGCTAAGAACAGGCTTCGAA GGTAGCTCAGTGGTAAAGAATCCACCTGCCAAAGCAGGCAATGCAGGTTC AGTCCCTGGGTAGGAAGATCAACTACAGTAAGAAATGACAACTCGTTCCA GTATTCTTGCTTGGAATATTCCATGGACAGAGGAGCTTGGTAGGCTACAG TTCATGGGGTCGCAGAGTTGGACATGACTGAGTAACTGAGCACACATTGC TAAGAGCGTCACCTTATCAATCATCCCTAGAGAAAATCATATAAAACTTT ACTTAAAAATTATACTACAGAAAGCCTTGCTACTGAAAACTGGAATTTTT CTTTTTCTTTAATAAAGATTGAGCCACCCTTTAGACTTCGCTGGTGGTCC AGTGGTTAGGACTCCCAGCTCCCACTCCAGGGCACCCAGGTTCAATCCTT GGTCTCCTGGTTGAAGAACTGGGATCCCACAAGCCACATGGCCAAAAAAC AAAACAAAACAAAGACTGAGCCACCCTTTTACTTTACTTCAGCAACAGGA AACTTAATAGCCACATCTGAAACTCGAATTTATGATCAATTTATTCACCT TAATACTTTGGCCACCTCATGCGAAGAGTCGACTCACTGGAAAAGACCCT GATGCTGGGAGGGATTGGGGGCAGGGGGAGAAGGGGACGACAGAGGATGA GATGGCTGGACGGCATCACCGACTCAATGGACATGAGTTTGAGTGAACTC CGGGAGTTGGTGATGGACAGGGAGGCCTGGTGTGCTGCGATTCATGGGGT CGCAAAGAGTTGGACACGACTGAGCGACTGAACTGAACTGAACTGAATGT TACATTCTTAGTTTTATTTTCTCTTGTACTGGCTTCATCACTTTTTTTAA AAAACAGTACTTCTTGTAGTTGTTTTTATAAAGTGACTCAACACCTTTGT GTAAAAGGTAGTGTACATGAGAATAAAACATAAATAACACATTTCCTTAC TGGTTTTCTCTGGCATTTATAAATCTGAAATACTTCAATATAGATACTAG GTAACATAATAGGATAAGATGAACTCCAGCATTTCAAATGAGGAGAAATT ATTATTCAGAACTCTCTAGAGTATACTTCCATATTTTAGTCTTAATACAT CCTTATACTCTTAAAAGAATTCAGTTTGAAAAATCTGAACACACTTCTTC AGACAACTTAAAAGATATACTTTATTCTTTGCATAAAAGAACTGAAAGCT GAATATAAAATCTTCCAGAATTGTAAAGTACAGAAAAGATAATCATGTGT CAAAGCAAAAATTTCTAAGAAAAGGCAATGAGAACTACGTACCTCGTGCC CCGG project fbnq AH 20040903 8294bp TACACCAATTTTTTTTTTTTTTATCCACCCCACTTCCCCCAAAAAAAAAA AAAAAAAAAAGTTTTTTAAAAAAAATTTTTTTACCCGAAAAAAAAAAAAA AAAACCCCCCTGAAACCCCCAATTTAATTTCCCCGGGGGAAAATGCCCCT TAAAACCAAAATAAAAGTGTGGGACAAAACCCGAAAGCGGGCTTTTTAGA ATGGCAGTGAAAAGGAAGGCAATTTTAAACTTAATTTTTTCCAAACCCCG ACTGTTTAAATCCCCCAGAAAAGAACCAACCCCCATTCGTTTTGTTTGTA GGGGGTAAAAAAAACCAGTTCCTGTTTCTAGTTTTTCACTCACAAACATG GCTTTATTATTTTTCTTGTAAAAATTCCTGAGGCCAAGCCGTATTCTGTA TTATTTGCTCGCTGCAACACTCCATCGACGTCCCTATAAGATGTTTTTAG GAAGACATAAAACCTCATTAAACGTAAAAGCAAAACACTTTCATTTTTAT GTTCTAATATTTTTCCCCTCTGTGTTAGAAACAGGAAAACGTTACTGCCA GTGTGCTTACATTTTTATAAATGAAATATTCCAGGCTTACACCAAAAGAA ACGCCCAATGAGATATTACAACCCTAGTATTGTATTTTTTCACATATATC ATGTGACACCCTTTAAAATCTGAGCTGAAGTCATCTTTTTAATCGTCTTC ATTGGTTTTCCTTCATGACTACCCCATTTGTCTTTCCCCTCAGTTCCATA TATAGATATTATATATTCTCAGAGCACCCTCTCAGTCCCTCCATCTATTC AGATTTTACATGCACAGTTCAAGGGCTCATTCCATGCCTCACCCTGAAGC CTTCTCAGATCCCATCAGTGCTACTGCTTAGGCGGTAGAGTGGAGTGGCC CAGTGAGAAGGCTCAGCAGCCAGACTGCCTGGGTGACCTTTGGGCAAATG ACCCCATCTCCCCCAGCTTTTCTGTATTCTTGTGAAAAAATGAAAATAGT AATAATAGCACCTCCTGTCTGTTGTCATAAGGATTAAATGAGCCAATAGT GTCTGGAACAAAGGAAATGCTCAGTGAAAGTCAGCTATAATTGGGTAGCC CACGTTCCTCCAACTCAGTCACCTTCCAACTAGACAGGAAGTTCCCAAGG AGAAAGAGAACATTTCATTTTTCTTTATACTAGGATGTGGCAACATCAAA TGTGAACTCAATTAATAGGCTAATCCCATAAAAGGGTAGTAAAATCATTC CTTCAGTGGGTCTGGTGACTTCCCTGCCTTCTGTCTCAGTATGTGTGCGT GGCCAAGTCAGTGCAGACATGAACCCACTCGTGTCTCCACTTGTTCCAGT TCCCATGTGCCTGCCATACAGTATCTCATTTTTATGAGTGTCATCCTAAT GTTAAAAAAAAAAAACAAAAAACATGAAATTTCTACAACATGGCCAGTAA ATGCAAGCCAAGATTTCATCTGGGGATCTGGCAAGGAAATGGGATTTCTG TTCCAAAGCTGGAAGAAAAATTAGTTGTGCTGAATTCTTTGAAGAGACAA CAAAGGCTTGAATGTGGTGCCTCCCCTAGGGATTTTCAAAGGTAATCTTG TCTCTATCCAATTTTCAACTTTCATGAGAAATGTGGAATCTCACTTGGAG TGGACTAGACTCTGCTAAAACTCTCACACTTGATGCACTGCACTTGATCG CACTGAAGATATTCATAGATTGGACTAAGGCTGAAAGATGGCTGGATGCC AGTGCCCACTGAGGACTGCTGAGATCACACAGCTTCATAGTACACCTTGT CCACTTTTAGAATAATAACAATGATTGCAACTGCACCAGCAGCAAACACA TTTAAATCTTCAGTCGCTCAGTCGTGTCTGGCTCTTTGCGACCCCATGGA CTGCAGCACGCCAGGCTTCCCTGTCCATCACCAACAATGACCCCAAAACA TAGATACTATTAATAACTAGCCCAACTTCACAAATAGATAAACTTTACAA ATAGAGAAACTTAATAGAGGAATTACGCTAGTAACCCAAGCCCACAGGGG TGGTCAGTGCAGACTCCACCCACTGCATTTCCCACCTACACCCTCTTGGG TTAACTGCCTGTCTCTTTGTCTGTCTCCCCTATTAGATGGTGACCTCCTT GAGGATAGGATCTGTGATTTATGTAGGCTTACATTCTCTAAACCTGGCTT CTAATATCTGCATGGTTAACACGACTATCATATAGGGGAATTTATAATTA GGAAAAGAGGTTAAAAGAGCATCTTTCGATCAGTATGTCAAAATGTTACT ACAATTTAGTGTCCCCAAAGTTCTCTTACAATCTATCAAAGACCAAGAAG CCCTTCTGAACTGGGTATTCTGTTTTTTACCACCTTCTCATTGGTTAAAG AAAAACTAAAGCCATAATTCTAAAGAACTGTGTGCAGTATACCAGAGAGT CTATTATATTAAATATTATGATAGGAACTCAGTTACCATATGGACTTCTT TGATATGCTAAACACTTTGGGAAGTTTCAGGGACCCTGACAAACCAGTAC GTCATTTACGGTTGTTTATAAGGTGACTGTGGGCTTTCTACAAAGAGTTG AGTTTTAGGTTTTTGGGGGCATGATCCCCTGTGGAGAAAACACTCCACTC TTTCTTTGGGAAAATCAGATTTCATAGATGATGCCTTCTCTAAAAATGTA AATGCAAAAACCACTTCTGTTAGTCTCAGTTACTGGCCTTATTCCAGAGA TGTTTCAAATGCCAACTGTACAAAAATTAAAACTAGCAAATACCATATGA TGTCAGCCATTAATTTAAGCTAAGGAGCAAAAATTTATTTCAACTTACAT TGTAAGTTAGCATTCTCTTCTAATTATTTGTCGATTATTATTATGGTAGA AATTGTATCGGAGAAGGCAATGGCACCCTGCTATGGTGTTCTTGCCTGGA GAATCCCAGGGACGGGGGAGCCTGGTGGGCTGCCGTTTATGGGGTCGCAC AGAGTCGGACACGACTGAAGTGACTTAGCAGCAGCAGCAGAAATTGTATG TTCTTTAACTGTATGCTCTGTATATAGCACAGTGGTAGGGAAAAAAAAAA CCTGTATCTAGTCAACCCAGTTAAATTATGCCTAGGAACATACCCATTTT GGAATTTAGAAATGACCATAATAGGCCCAAAGGATTCCTCTTTGGCAAGA TACATGTGGTCTTCCACATCTGTGAAGACAGTAGGTTCCATAAAAAAGCC TATTTGAAAACCAGAAGAAAATAACATCAATTATAGTGTAATTTTCAATT AGTAGTTCTCTCATTTAATTACATTACAACTTTTATTTCTTCCCTTCTGG GTCAGTAAAACCAAGAAGACTTTCATTTTCCTATTTGGTGTTAACAATCC TAGGTTCTTATACTTTTAATGTCCTTATTACAAATATTTCAAACATATGT AAAAGTAGAGAAAATAGTATAATGAATAGTAAAATAAATCTTTATGTATA TATTTTGCTAGATTTGATTCATTTTTTCCTTGCTGATATAGTTTAAAGCA AATTCCAGAGACATAGATTTGTACTAGAATACTTGGAGTATAAATTGTAA TGTACATTATCATACCTAACAAAATTAACGCTAATCCCTTATTCATAGTT TTTTTCAATTTAACTTCTAATTTTTAAATTGAGATATAATTGACACATAA CATTAATTTCAGATGTACAACATAATGATTTGATATTTGTATTCAATTTC TGATTTCTAGAAAATATCTCTTTGTAGTTCATTTGTTTGATTCAGGGATT CAAATAAGTTACACTTTGCATTTGGTTGTTAGATAGCTTTAATCTGGAAC ATTTCCTCCCTTATGCCCACCCCTTAATTTTCATGGCACTGACTTGTTAA ACCGGTGAATTCACAGTGGGAAAGAATCTGCTTGCTAATGCAAGAGATTC AAGAGACACAGGTTCGATCCCTGGGGTGGGAAGATTCCCCTGGAGTAGGA AATCGTAACCCACTCTGATATTCTTGCCTGAAAAATCCCATGGACAGAGG AGCCTGGTAGGCTACAGTCCATAGGGTTGCAAAGAGTCGGACATGACTGA AGTGACTTAGCACACATGCATGACTTTGTTAAACAAACTGATTCAGCTGT CCGGCAGAATATCTTAGGCATTTCAGATTTGTCATTGCTTCTTTGGGATG ATATTTGATTTGTTTCCCTATCCCCTGTGCTTCTTTAAATAGAAAATATG ACATAAAGGCATGGTTAGATTCATGGTTAAATGTTTTTGGCAAGAATACT TCATCGGTGATGGTGTGTTACACACTGGATCCCATAGAAGACATATCATA TCCAGTCGTACGGCTGGTACTCAGTCTATCACAGTAAGACAGGAGGTTTT ACACCTGTTGTTTGTTCATTTTTCTCTCCTTTTGGGTATCATGACATGGA GTCATTCACATACTTCTGTAACAAGTACTGGGTTCAGTTCAGTTCAGTCT CTCAGTCATGCCCGACTCTTTGCAACCCCGTGGCCTGCAGCACACCAGGC TTCCCTGTCCTTCACCAACTCACAGAACTTGCTCAAACTCATGTCCATCG AGTTAGTGATGCCATCCAACCATTTCATCCTCTGTCATCCCCTTCTCCTC CTGCCCCTAAACATTCCCAGCATCAGGGTCTTTTCTAATGAGTCAGTTCT TCATTAACAGTTACACAACAGGAATGAATCCTTCCCAGGCTAAACTGGCT AAGATTAAGCCTCACATTGCCAGGAATGAAAACCGCCAGTTCCTGAAACA CACTTATCCATTACGCTTGTTTACTGCACAGCTAAGGGCCTGTCACATCA TTTTATTTGATTTTCACAGCCTCGTAATTTTTGATGTGCACATTTCATCG CATTTTACAACTAGGGCTCAACAAAACTATTGTTGAAGGTGTCACAGCTT AAAAGTGGCCAAGCAGGATCTAGAACGTATTTCTTCTGATCATAACATAA ATGCCACTGTTTACTTCTGAGGCAAGATGGTGCTATAATGAAGCCTGTTA CCAATTATTCCAACTTAAGAAGCCAGGCCCCCAGCATCCCTCCCCTGGAG GTGATCATACCTGGCCTTTGGACTTGTCTTCCTCCGTACACCAGGGTGGC CCCCTCTTTCACTCCAGCTTCACAGTACTGCAGAAGCTTTTCCAGATGGG CCTTATGATTTTGGGGCCCATGATCCGTAAATCTGTCTAGTGGATCACCA ATTTTCATCTTTTTAATTTCTTCCACCTGTATATCACCCCAGTTTGTAAA CACAATTGACTGTTAGTAATGGATACCCTTCACCAAGCTTCTGCTGGGTG ATGGGTGTTGTACTGAGCTCTTCCCTGATGGTCCTCACTTAGTCTTCATG GTAGCATTGGAGGTAGATATTTATTTCCATCTTACATATGAGGAAACTGA GGATCAGAGGGGCTAAGTGACTAGCCCAAGGGCACACGACCACTAAATAC TGTAGAGTTTTCTTGATGTGAAAGCCCAAGCTTTTAACCACTGAGTTTTA AACAGAACACAAGCCACATGCATTGTATTAAAATTATCTTGAATGTTAAT CCATTAAAATAGCAAACCTGATGTTCTGGAATTTTTGTCAATACAGCATA CTCTTCATGGCAAAGTAATTTCTAAAATGGCCACATTGTTGTCTTTTCCT CTCCCTAAATGTGGCCGACTGCCCTCGTGAAAATCTCACGGTATAGCCAC ACTGGAGGACATACTAGAATGTTCTGATGAAAAACCATCTTTACATGGAA CATTCATCACTCACACATGCTCCTTGGTTATCTTTTTTTTTTAACTTTTT ATTTTGGAGTATAGCCAATTAACAATGTCGTGATAGTTCCAGCCAATTAA CAATGTTGTGATAGTTTCAGGTAGACAGCAAAGAGACTCAGTCACACACA TACAAGTATCTATCTATTCTTTCCCAAACTCCCCTCCCACTCAGGCTGCC ACATAACATTGAGCAGAGTTCTCCGTGCTATACAGCAGGACCTTGTTATC CATTTTAAATACAGCAGTATGTACATGTCCATCCCAAACTCCCTAACTAT CCTGTCCCCCCATCCTTCCTGCCCCAAAGCATAAGTTTGTTCTCCAAATC TGTGAGCCTGTTTGTTTTGTAAATAGGTTCATTTTGTATCATTTCCTTTT AGATTCCAATATAAGGGGAGTCACACAATATTTCTCCTTTTCTGTCTGAC TGACTTCACTCAGAATGACAATCTCTAGGGCTCCTTAGTTATCTTAATCT GTTTCTGAATTTCTTGTTGTTAAGACCAATTCTAATAAGGAGAAAGAATG GGAGTTACCATAACCCCACAGGGCCATGAATTTTGAATTTAGGTCTGGCT AAAATCCCTCAGTAAGTGCTCAAAAAATAGCCATTGAATAAAGAAATTAA TCCTGTTCCTATGTGTGCAAAACATATTATTGATGGACTGACAGCAGCAA ATCTGTGACATTTCTGGTCTTAGCATTTGAAATTTCAACAAGTTGTAGTT GTGAAAGCCCATGATGTGTCATGCTGTGCCCTGTATTTTACTAAGGCAGA AACGTGAATTTGCGGGGTGCTCATGAGCTGGACACTGCCCGCCGTCTGCC CTTCTGTATGGCTTCCTTGTTTCCTACTCTCATGAGGAAAGATGCCTTTG CTTCTTGGGGGTGGAATTGGGGAATTGGCTCTGAAGGCAAAGAAAAACTG GGTGCTGGTTTTTCAACTAGAAACAAATTTGTGATTACTACAACCATAAT GATGATACACTGCAGTATGTTCAGAGTTCATTTTTACCACAGAATTCATC TTAATAGTTCTATAAATGCTTCTAGTCTCATATTTACGGAATCGTGTCCA ACATCAAGGGGTATGTAGGTATGTATCTATCTTAGTGGAGGAAATATATA TGCTGTCATTTTACTGTAAATTCAGGGTTTGTAAGAATCTAGTGGTATAC CTCTCATAGGCAATTTAGGGATTTATAATAACCTAGGGGTATATATCCCA TAAATATCAAGGATCTAATATACTATAAATACAGAGCAAGATAAAGGTAA TAATAGCTCTTCAGTATACTTTATCAGGTTTTTTAATATAGACCTATAAC TTTTTACTATGAAAAATTATAATTATATATAAAAGTAGGCAAATAATATA ATGAAACTCCATGTACCCATCAGTCAGCTTCAACTACTGCCAAGCCATGG TCAATTTATTCCCTGACTTACTTCCTCCCCTTCTGCATTATTTTGGAGCA AAATCCAGATATCATAATCTAATCTGTAAATATGTCAGAAAGTACTTCTA AAAAATAAGGATTGTGTTGTTTTTTAAAAATATACTATCATCACTAATAA TCCCAGAAGTACTTTGGAAGTAAAGACAATTTCTATCCAACTCACAGAGC GAATCTGAAGATGCTTACCATTCTTGTCACAAATTCATCGTGGATGGATT CTTCCACAAACAGCCGACCAGCTGCAATACAGTTTTCTCCTTTGTTGAAA AATACTGCCCCCATGCCCTTTGGCAGCAAAAGACAAAATACTTTGTGATT TGGGAAGTCAAGGTTGTCATAAAATTGCACACACTAAGAATTGTCTTATC ATAAAATAGCAGGCAATACAGAGAAATCAGAAAAAAAACACAAGCCCTTG GTCTAGTTAGTGATGCTTAGAGATTCTTGGTTTTGATATTTTTAGAAATT TTATTTCTCCTTTCCCCTTTTCTATCCATGAGTACTTTACAAGAGATGTA CCTATCAAGGATGACATACCGATAAAAAGATTTTGTGTTATAAGAAAATG TAGACTATACATTTAAATGTAATGTTTGCATGCCAAATTTTGCTTTTAGA ATCTCTACATCGGTTTATATAAATCATGAATGTTTATAAACCTCTTCATC TGTTTGTAAAAAGCTGGCCTCCAAGTTTTAAAAACACCTTTAATTATAAT GACATTATTTTTTAAATTAAGTGCCCTGAGCAATCCCAAATCGAAGCATA AAGAGAATGGTTTCTGTTTATGGTCAGATAAAACCAGACCTCATTTTAAG GCACCTGATGAACAAGAAGCTGAAATGTGTTTCAGAAGTAGCACCTATTT CACTGGACTTGATCTCCTCTTACCATTCGCACAGCCTTGTCAAGTTCACA GTCACTGAATATTATAAGTGGGGATTTTCCACCAAGTTCAAAGGGAAACT TTCTTCAAGTTGATGAACNNTANCNTACCATTCCGTGTCTCCCC project fbnq AI 20040903 8055bp TGGTTGTATAAACACATAAAATTTTGTTTTTGTTTATATATTTTTATTTG TTATTTTTTTTTTTTTTTTTTTCCTGTTTTTTGTCTTTGTTGTGAGAAGG GGGAAGGTTCTTTTTCCGTCTTTTTTTCTGGTTCCTTTTGCCCTCCCCCC AGGGAAAATTATTTTCCCACGAAAATTTTTCGCGGGCCGGAGATTTTCGA GAGGGGGGGGGCTTTTCCCTCTCTCAAAGGGGTTTTTTCCCAAACCCCGG GAATAGAACCCAGGGTTCCATGTCTTTGGGAAAGTGGAGGCCAAGGGGGG CCCAAGAAGACTTTAGGGGTTTGCTGTTCCTTCTGTCGGAATTTTTACCA AACTGGAATTAGACGGGGGGATTGGCTAGGGAATTCCTGCTATGCGGGGG GACTTTTTATGTATGAGTTGGTGTTCTATTGTGAGAAAGCTTTCTGTCCT TCCATTTACTTATTTGTTCACTTATTTATGTCTGTTTAACTCATGGATTT TTATTCTATTTAAAGGGCTTAAGCCATTACTATTATAATTTATCTTGATA CAAAATTGTCCCAGAGGGAGCTCTTTCTATTTGCAAATCTCTCCTTTTCA TGTATCCTCGTCTTTTTTTGCACACTTCATTAATTTCTGGTACAAGTTGT TGCAGGCTCATTTTGTACTTTCCTGTCCCCAGCCCTGGAATTAACCTTTT CTCCAAGGTTCCTTTTAATGGTGAGAGTGGTATTTGGAAAGTAAGATCTG AATGTGTTAGTTAGCTAGGTGTGCTAATTGTGGCTCCTTGGTAAAGAATT TGCCTGCTAATGCAGCAGATGCAGGTTCAATCCCTGGATTGGGAAGATCC CCTGGAGGAGGAAATGGTAACCCACTCCAGTATTCCTGCCTGAAAAATCC CATGGACAGAGGAGCCTGGCAATTTACAGTCAATGGGGTCACAAAGAGTT GGATACAACTGAGTGAGTGAGCATGAACACACAGTAGCTAATTGCTACTG ATGTGCCCTAGCTCTTAGGCTTTTCCATTGTAGAGGGCAAGGAAACACAC ACATACATATCCTTATCTACAATATATCTATATTTATTTCTATATTTATC TATATATATATTTTTTTCAAAAGCTTTTTATGCATTCAACAAGATAACTA TATGGTTTTTGTTCTTTAGTTTGTTTATGTGATGTATGACATTGATTGAC TTGTGGATATTGAACCATCTTGCATTCCTGCAATAAAGTCCATCTTGATG AATGATCATTTCACTGTTGATTTTTCTTTGATAATATGTTGTTGAAGAAA TTTTCTTCTATGTTCACCAGGGATATTAGCCTGTAATTTTCTCTTTCTTT TTTTTTTTTTGTGGTCTCTGTTGGTTTTGTGTCAGGGTGGTGATACATGG AATGAGTTTAGAAACATTCCTTTCTCTTTGGAATAGTTTGAGAAGCATAG GTGTTAACTCTTCTTTAAATGTTTGGTAGACTTTACCTATGATTTTTACC TATAGATAATATTTATCTATATTTAAAAACTTCAAGAATGAGAAGCTTGC CACAGTGTGCTGGAACCAGTATGAACCAGCTCACGAAAGCTGATTACTAG CTATTTGTAATTTTTTGAGCTGATCGTTGCCTGAAAATCAGTCATGGGAC CATTTATATCATTGCGATTGGCAAATGCTGCAAATCAAATTTTCTTATTC CCCTTCCCCCCTCCTCCCACAGAGAACCAGTTTAGCAGAGAACCACTGGA AATCTGAATTTCATTATTCTCAATATATTTATTCATCATACATTACATGG TAAAAGGGAATTAAGGTTGCTAATCAACTAACTTTAAAATAGAGAGATTA TTCTGGATTGTCTGGTAGGCCCAATGTATTCAAAAGAGCCTTTAAAAGTG GAAGAGGGAGACAGAAAAAAAGAATCAGAGTTGTGATGATGAGAGGGTCA GAAATGCTGTGTACACTGCTGTCTTTGAAGACAGAGAAGGGGGGCCACAA GCCAAGGAATGTGGTCCACCTCTAGAAGCTGGAAAAGGCTGGAAAAATAG CCACCAGCATCCCAGTGTTAGAGAAAGCCTGTCTCCCAACAACATCCAAA ATGTCAGGGTCAAGGAGCAAGAACAATGCTATACATAATTACATTTTAAA ATCTATTCATAATTCTGCTAGGAGTGGAACTAGAACAGAAAATCAAAATG CCAGTAGCAGCATCACTAAATGCAAAGGAAGTTCAATTAAAATGTATTTA TTCATTCATTTCAGGGTAAAAATTATTGAGTATCTGTTTAAGGCTAAAAA

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnq.fa (2013-03-31)
    Open archived version from archive


  • CTGAAAACAGAAGTATGGATAGAATCATACTACATGTATGTATATGATTA ACTGAAGAAACAAGATGAGAAAAGTTGAACTGTGCTTTTCCTTTTAAACT GAAAACTAAACACAGAATATTTTCTTTATAATGGAACTCATTATCTTTTG AGCAAAAATGTTCAGTTTTGATTTCCAAAATGGTGTTTCAGAAATCTGCT CTATACATGTTCTGCCACAGATACAGTACAAGCTTTATAAGATAAGCCAG GGTGGAATTTTACCCTTGCCTTTTACTAGATTTGTACTTTTGGTTGTTGA TCTCTCCAGAGGGAATTCCTACTTCCTTGAACCCTCCCACAAATTATACA GCACAAGTCTAAATCCATTAGCAAGTTCCTCCTAACACTCCTGCTAAAAT GCCCCACAGGTCCCCACGGTAAACCATTTTCCTTGTTCTGCAAGTATCAA TCAACACAGTTTTGTTACAGGGATTGTATGGTATTCTCTGATGGTTTTTC CTTTAGTCATGTATGAATATGAGAGTTGGACTATAAAGAAAGCTGAGCAC CAAAGAATTGATGCTTCTTAACTGTGGTGTTGGAGGAGACTCATAAGAGT CCTTTGGACTGCAAGAAGATCGAACCTATCTATCCTAAAGGAAATCAGTC CTGAATATTCATCGGAAGGACTGCTGCTGAAGCTGAAACTCCAGTATTTT GGCCACCTGATACAAAAAACTGACTCACTGGAAAAGACCCTGATGCTGGG AAAGACTGAAGGTGGGAGGAGAAGGGGATGACAGAGGATGAGATGGTTGG ATGGCATCACCGACTCAATGGACATGAGCTTGAGTAAACTCAGGGAGTTG GTGATGGACAGGGAAGCCTGGCATGCTGCAGTCCATGAGGTCGCCAAGAA TCGGAAACGACTGAGCGACTAAACTGAACTGAACTGGTCTTCTCCGATGG ATGGGCATTAGAACCCTCCTGTCTGTTCTCAAAATAGTACGCATAGTGAT TCTATTGAGTCAGTTCCTGGAAGCCCTCTCTGCTAAGTGCCACAATGGTT CCCCATCTCACTCATTTAAAGCCAGTGACCTTACAATGACCCTGTAAGGT CTTAACTGAATGGCATTCAAACTTGGTTGCATATTAAAAATCACATAGGG AGCTTTAAAATTGCTAAGCCTGGGTTGCACCTCCAAGTGACTGCAATGTT AATTGGCCATGACAGCTAGAGCTTTAGAAGCTCTCTAGATATTGGAATGG TCAAAAAGTTCATTCAGGTTTTTCCATGAGATGTCATGGAAAAACTACAA GGAACTTTTGGCCAACCCAATACTTCACAGGGCCTTCCTTGGTGGCCCAG ACGGTAAAGAAACTGCTTACAATACTGGTGAGACCATTCCCTGGGCAGGG AAGATCCCCTGGAGGAGGAAATGGCAAGTCGCTCTAATATTCTTGCTTAG AGAATCCTATGGACAGAGGAGCCTGGTGGGCTACAGTCCATAGGGTCACA GAGTTGGACGACTGAGTGACTTTCGATACTTCTCAAATGCAGTCAAGGTT GAGAAGCACGGCTTTAGATCATTTGTTTATTATTCTGGCCTCATTTCCTA TTATTTTTATTTTTATCTTTTGTTAAAGAAATCCTTTATTTTCTCTTTTT TTTGGGAATTGTTTTTATTTATGTATTTTTGGCTGTGATGGGTGTCCGTT TCTGTGTGGGCTTTTCTCTAGCTGTGCCACGTGGACTCTGCTCTCTAGTT GTGGCGCAAGGGCTTCTCATTGAGGTGGCTTCTCTTGTTGCAGAGAATGG GCCCAAGGGTGCCCAGGCTTCTGTAGTCGGGGCCCATGGGTTCAGCAGTT GCAGCTCCCAGGCTCTAGAGTACAAGTTCAATAGTTTTGGAGCACAGCCT TAGTTGCTTCAAGGAATGTGGGATCTTTCCTGATCAGGGATGGAACTTGT GTCTCCTGCATTGGCAGGCAGATTCTTTACCTGAGCCCCCAGGGAAGCCC TTACTTTTTTTCTTATAATCACTCTCTTCCAGCCAAACAAATCATTTGCT ATTGATCAAACTCACCAGATAGCCTCCTGTTTCCATCCCTTTGTTTTTGC TTTCTGCCTGAAAATCTTTTCTCTGAGATATTCTCAGTTTATTTCCCTTC CCTTCTTCAGTCTGCATTAAACCACCTTGTCCTTGAGAGCTACTATGACA ATCCTATTTAAAATTGCAAAGTCATCCCCTCCATCATTACCTGATTGCCT TTACACCACTCTATTTCTTATAACATATACCCCTTCTAAAATAGTATGCA CTCTGCTCATTTATCATAGTTTCAGTCTCTCCCCTACTTGGAACAAGTTC CAAGAAGAGAGGGATATCTGTCTGTTTTACTTATTGTGGGATCTATATGC TTGGCATAGACCAGGCACTCAAAACGCACTTGTTAAAGCATCAGTGGTGA CCTTCCTTTTTCCAGAAATAATTTTTTTCTCATTTCTTATTTTCCCCCAT ATTCTTGATTCTATTACTGAGTTAGACATACTTAGTTGGGACTCCCTAAT ACAAGCCCACTTATCAGTCCATCCACTCCTAAAAATTCACTCCTATTTTT TTTTTTAACTAGGCTTCTCCTTTGCCAGAGTTCCCTAATTGTGTGTCTCT CTTTAGGTTCTATTTGACCCTTTTTTTCATCTTACTTATAATTATATTTA ATTGCCTCTCAAAGGAGATGTAATTAAATATCATATTTCATCTGGAATGG AAAACCTCAAGTGGTGTCACCACGTCAGATTTTCAGTTAAAAACACTGGC TCTTAGCCTATACTCTCTCCCCAGTATATTCCATCCAATATCAAAGTTTC AATTACTTTATTATGTCAATAAAATTATTCAATAATTATTTCTTCAACTC ACTGTCCTCTTGTTAATGCCAGAACTATCCAAACTACAGACAATAATGAT CTCCTCCTTCAATCTTACTTCTCCATCTTACTCACTCTATATCCTGTGAT TCCAGATAGAAATACTGATAAGTATTACATAAGACACCCATTTTCCATTC TACCAAAATTCACGGATGCCCCTGGCATCCAGTGGTTTAAGACTTCACCT TCCAATGCAGGGAAGACTAGACACAGACCTTATACCCCTCACAAAAATTA ATTTCAAATGGATCACAATCCTAAATGCAAAATGTAAAACTATAAAACTC CTAGAAGATAACTTAGAAGAAAATTTAGATGACCTTGGGTATGGCAAAGA CTTTTTAGGTACAACACCAAAGCATAAGCTACGAAAGGAATAATTAATAA GCTAGACTTCATTAAAATTAAAATTTTCTGCTCTGCAAAAGACAATGTCA ACATATAGTATTTCTCTTTCTGTGTTTGACTTATAAGTCACAGGTAGGTA ATATATAGCACAGGGAATATAAAGTCAGTAATATTATAACTTTGTATGGT GCATAATCTATAAAATATAGAATTATATGTTGTATACCTGAAACTAATAT AATACTGTTAAGTCAACTATACTTCAATTAAAATTTAAAAAGACAATGTC ATGAAAAGAATGATAAGACAAACCACAGACTGGGAGAAAATACTTATGAA AGACACAGCTGATAAAGGACTCTCGTCCAAAATTTTAAAAATCTTAACAC TCAACAATAAGAAAATAAACTACCTGATTAAAAAATAATCCAAAGACTTG AAGACACCCCACCAAAGAAGACACACAGCTGGCAAATAAGCATATGAAAA GATGCTCCATGTTTGTACATGCAGCAAATTTTTGTACATGGAAATGCAAA TTAAAACAACACTGAGATACCACCACCCACCTATTAAAATGGTCAAAATC TGGAACACTGATGACAATAAATGCTGGTGAGACTGTGGAGCAACAGGAAC TCACATTCATTGCTGGTGAGTATGTGAAATGGTACAGCCACTTTGGAAGA CAGCTTGTCAGTTTCTTAGAAAATTAAACACAATCTTACATATAATCCAG TGATCATGTTCCTTGGTATTTACCCAAAAAGGAACCAAAAATGTATGTCC ACACAAAATCCTGCACATAGATGTTTATAGCTGCTTTCTTCATATGAAAT ATTGAACAATGGAATATTAATCAGCACAAAAAAAGTAATGCACTTGAAAG CCATGAAAAAAACCTTAAATGCATATTACTAAATAAAATAAGCCAATCTG AAATGGTTATAAAGCATATGATCCCAACTACCTGACCTTACAGCAAAGGC AATAAACACTATGGAAACAATGAATGGATCAGTGTTTGCCCATAGTTGGG AGCAAGTGAGGGACGGAGCAGCAGAGCACAGAGGATTTTCTAGGGCAATG GAAATATTTTGCATGATACTGTAATGATGGATATATGTATTTATTTATTT GTCCAAACCCATAGAATGCACAACACCAAGAGTGAACCATGAGGTATATT GTGGACTTCGAATGATCATGATGTGTCAGTGTAGGTTCATCAACTCTAAG AAATATCCCATCCTGGTGGGTGATGCTGATAATGGTAGGGGTTATGCATG TATTAGGAGTAGGGGTTCTATAGAGGCTCTCTACCTTCTCAGTTGTGCTG TGAACTTAAAATTGCTTAAAAATTTTTTTTATTATATTTTATTTTTTAAC TTTACAATATTGTATTGGTTTTGCCATATATCAACATGAATCCACCACAG GTATACACATGTTCCCCATCCTGAACCCTCCTCCCTCCTCCCTTCCCGTA CCATCCCTCTGGGTCATCCCAGTGCACCAACCCCAAACATCCAGTATCGT GCATCAAACCTGGACTGGCGACTCGTTTCATATATGATATTATACATGTT TCAATGCCATTCTCCCAAATCATCCCACCCTCTCCCTCTCCCACAGAGTC CACAAGACTATTCTATACATCAGGGTCTCTTTTGCTCTCATACACAGGGT TATTGTTACCATCTTTCTAAATTCCATATATATGTGTTAGTATACTGTAT TGGTGTTTTTCTTTCTGGCTTACTTCACTCTGTATAATAGGCTCCAGTTT CATCCACCTCATTAGAACTGATTCAAATGTATTCTTTTTAATGGTTGAGT AATACTCCATTGTGTATATGTACCACAGCTTTCTTATCCATTCATCTGCT GATGGACATCTAGGTTGCTTCCATGTCCTGGCTATTATAAACAGTGCTGC AATGAACATTGGGGTACACGTGTCTCTTTCAATTCTGGTTTCCTCAGTGT GTATGCCCAGCAGTGGGGCTGCTGGATCATAAGGCAGTTCTATTTCCAGT TTTTTAAGGAATCTCCACACTGTTCTCCATAGTGGCTGTACTAGTTTGCA TTCCCACCAACAGTGTAAGAGGGTTCCCTTTTCTCCACACCCTCTCCAGC ATTTATTGCTTGTAGACTTTTGGATCGCAGCCATTCTGACTGGCGTGAAA TGGTACCTCACAGTGGTTTTGATTTGCATTTCCCTGATAATGAGTGATGT TGAGCATCTTTTCATGTGTTTGTTAGCCATCTGTATGTCTTCTTTGGAGA AATGTCTATTATAGTTCTTTGGCCCATTTTTTGATTGGGTCATTTATTTT TCTGGAATTGAGCTGTAGAAGTTGCTTGTATATTTTTGAGATTAGTTGTT TGTCAGTTGCTTCATTTGCTATTATTTTCTCCCATTCTGAAGGCTGTCTT TTCACCTTGCTTATAGTTTCCTTTGTTATGCAGAAGCTTTTAAGTTTAAT TAGGTCCCATTTGTTTATTTTTGCTTTTATTTCCAATATTCTGGGAGGTG GGTCATAGAGGATTCTGCTGTGATGTATGTCGGAGAGTATTTTGCCTATG TTCTCCTCTAGGAGTTTTATAGTTTCTGGTCTTACATTTAGATCTTTAAT CCATTTTGGGTTTATTTTTGTGTATGGTGTTAGAAAGTATTCTAGTTTCA TTCTTTTACAAGTGGTTGAACAGTTTTCCCAGCACCACTTGTTAAAGAGA TTGTCTTTAATCCATTGTATATTCTTGCCTCCTTTGTCAAAGATAAGGTG TCCATAGGTGCATGGATTTATCTCTGGGCTTTCTATTTTGTTCCATTGAT CTATATTTCTGTCTTTGTGCCTGTACCATACTATCTTGATGACCGTGGCT TTGTAGTAGAGCCTGAAGTCAAGCAGGTTGATTCCTCCAGTTCCATTCTT CTTTCTCAAGATTGCTTTGGCTATTCGAGGTTTTTTGTATTTCCATACAA ATTGTGAAATTATTTGTTCTAGTTCTGTGAAGAATACCGTTGGTAGCTTG ATAGGGATTGCATTGAATCTATAAATTGCTTTGGGTAGTGTACTCATTTT CACTATATTGATTCTTTTAATTTTAAAAAAAGGCTAGTGCACTAAGAAAA AAATTTTGGTATCTTAAGACTAGGGCCAATCAAAGAGTCAATCTATAACT TTCACTCTAACTCCTACATACTTCTCATCAGAATTAGAATCATGGCTATA TTAGTGTAATATAGATCTCCCCACTAGACTGTAATCCCTAAGAAGGTAGG AACTACATGTGTCTTGTTCACCCTGTAAACAGCTGTTGAATCAAGTACAG TGCTTGATAAATATTTATTGAATGCATAAACTAACCCCAAGGACAGCAAG TGTTAAACTACACCTGTTTCCTGCTATTATCCACTCTTTTCAGGCCCTCT CCCAAAGTATCCACTTCTCTAGCCCAATATTACAACACTAACGCCCCAGG TAAAAACTTTCCCAGCTAATTTGCCTCACTCTACTTTTATCGACAGTAGA TAAAATTGATTACACCATGCAAACTGTGCTTCCAGCGAACTTCACCTGTG CTGCATGGAATTTTCAACTGAAGTCAAGAAATGTTTATTCTCAAACTTTT CATTAAACTTTCCCCACAAGTTTCTCATTTTAGAATCTGATTCATGCCTA TCCTAATCCACCCTTATTGTCTATGAAGCAAAACCAGCTTTTTCTATTAG TTACATTTTTATGTATATTTTCATCTATTTTTTTATTTTTAATTGAAGGA TAATTGCTTTACAGTATTGTTTTGGTTTCTACCAACACAATATGAATCAC AAACATCAACCTGAATCAGCCATAGATTTATCCATGTGCCCTCCCACTTG AACATCTCTCCCACCTCCCTCCCCATCTACCCCTCTACGTTGTTACCGAG CCCCGGTTTGAGTTCACTGAGTCATACAGCAAATTCCCATTGGCTATCTA TTTTACATATGGTAATGTATGTTTCCACGTTTCTCTCTCCATATCTCCCA CCTTCTCCTTCCTCCCCACCACCAGCTGTGTCTATAAGTCTGTTATCAAT ATTTGTGTCTCCATTGCTGCTCTGCAAATAGGTTCATCAGTATCATCTTT CTAGATTCTGGTCAGAATCTTCATACTCTTCTCCATAGTGGCTGTATCAA TTTGCATTCCCACCAACAGTGCAAGAGGGTTCCCTTTCCTCCATACCCTC TCCCGCAGTTATTGATGGGCAAATTTTTTGATGGCCATTCTGACTGGTAT GAGGTGATAACTCATTGTAGTTTTGATTTGCATTTCCCTAATAATGAGTG ATATTGATTATCTTTCCAAGTGTTTATTAGCAATCTGTAGGTCTTTGGAG AAATGTCTGTTTAGGTCTCTTGCCCACTTTTTTATTAGGCTATTTTTCTG GTAACAATTTGTATGAGCTGCTTGTATACTCTTAAAGTTAATCCTTTGTC AGTTGTTTCATTTGTTATTATTTTTTCCCATTCTGAGGGTTGTCTTTTCA CCTTACTTACAGTTTCCTTTGCTGTGCAAAAGCTTTTATTAGGTCCCACT TGTTTATTTTTGCTTTTCTTTCCATTACTGTAAGAGGTAGGTCATAGAGG ATCTCACTGTGATTCACGTCATATAGTGTTCTGCCTGTGTTTTCCTCTGA GTTTTATAGTTTCTGGTCTTATATTTAGGTCTTTAATCCATTTTGAGTTT ATCTTTGTGTGTAGTGTTACAAAGTGTTCTAATTTCATTCTTTTACTGGT AGCTGTCCAGTTTTCCCAGCAGCACTTACTGAAGAGACTATCTTTGCTTC ATTGTATATTCTTACCTCCTTTATCAAAAATAGGATATCCATAGATGCAG GGGTTTATCTCTGGGCTTTCTATCTTGTTGATCTTTGTTTCTGTTTTCAT GTCAGTACCATCCTCTCTTGATGACTATAGCTTTGTAGTATAGTCTGAAT TCAGAAAAGTTGATTCCTCCATCTCCATTCTTCTTTCTCAAGATTGCTTT GGCAATTTGGGGTCTTTTGTGTTTCCATATTAATTGTGAGATTTTTTGTT CTAGTTCTGTGAAACATTCCATTGGTAATTTGGTAAGGATTACATTGAAT CTATAGATTGCATTTGGTAGTATAGTTATGTTCACAATATTGATTCTTCC TAACCCAGGAACATGGAATATCTCTCCATCTGTTTATGTCATCTTTGATT TCTTTCATCAGTGTCTTATAGTTCCCTGTATACAGCTCTTTTCTATCCTT AGGTAGGTTTATTCCTTGGTATTTTATTCTTTTTGTTACAATAGAAAATG GGATTGATTCTGTTAGGCGAAGCACACTGACTGAAACCGCCCACCCTGGC CAGGCCCTTTAGTAACTATTCGCATGAGTTGTTTTATGACAGGAGATCCT GGTAAGGAACACGGAACTAATAAGCGACCACCAACCGGAAGAGTTTGGGA AAGGTCAAAAGGAGACACCGCGTGTCCGTCCACATCCCAGAATCCCTCTC GCTAGCATCCATCTTGGCTGGACAATGCGTGCACCACCAGGAAAGACTCT GAATTAGAATGATTTGCCAAAGACAACCCGGAAACTAATCCCATTACCAC CAAACCTGAGACTGCAAGCCACGCAGCAGAGCAGTTCTCCTGGGTTCCCT TACCCTCCTGCTCTCCACCCGGGTGCCCTTTCCCAATAAAATCTCTTGCT TTGTCAGCACATGTGTCTCCTTGGACAATTCATTTCCTAGTGTTAGACAA GAGCCCAGTTTCGGGCCCTGGAAGGGGTCCCCCTTGCAACAATTCCTTGA TTTCTCTTTCTGATATTTCATTGTTGGGGTATAGGAATACAAGTGATTTC TGTGTACTCATTCTGTATCCTGCCACCACTTTGTAAATTCAGTGATTATC TCTAGAAATTTTCTGAAGATATCTTTAGGATTTTGTATGTATAGTATCAT GTCATCTGCAAACAGTGAGAGTTTTACTTCTTTTCCAATCTGGATTCCTT TTCTTTCTTTCTGTTCTCTGATTGCCACAGCTAGGACTTCTAAAACTATG TTGAATAGTAGTAGTGAGAGTGGGCACCCTTGTCTTGTTCCTGATCTTAC AGGGAATGCTTTCAGTTTTTCACCATTGAGAACAACATTTGCTGTGGTTT TATCATATATGGCCTTTATTATGTTGAGGTAGGTTCCTTTGATGCCCATT TTTTGAAGAGTTTTTAATCATAAATGGGTGTTGAATTCTGTCAAAAGCTT TTTCTGCATCTATTGAGATTATCATATGGTTTTTATCTTTCAATTTGTTA ATATGGTGTATCACATTGGTTGATTTGCATATATTTAAGAATGCTTGCAT GCCTGTAATAAACCCAACATGATCATGGTGTTACGACCATTTTAATGGGT TGTGGAATTCCGTTTGTTACTCACAGCAGAGCAAATATATTAACATCTCT ACATACTCTACACACATTTCTTTTAGCAGATATTAAGTACAACCACTGTT TATTATTATTATTAACCAGGTTACTGGCAATAGATTATCATGACTTCTTT TATGCACACTGTCTAGATTTTCTCACTAGATTGCTTTTCCCTAAAGTAAA AACTCCTTTCTATGTCTACCATACAAACCTAACAAAGTGTTGGAAATGTT CAAACAGTCTTAAAATACAGTCACTGGAAATACCAACCTATTTTAATGCC TTTCTTATAAATACCCATGGGGGTGAAATGGTTCACAGTCTTTGAGAACT TTACAAATTTAAGCACCCTGAAGACTCAGTGGGTGAAATGATAATCAATC CCAAGATCCATTTATCACACCACCTCTATCTCTACTGAACTAACTGCATG ACCACAACCACAGGAAGAGCTGTGATATTCATTGTGTGTGCCTATTTTTC TTAGCTATACATTATTTAATACATATAAATTCATTTTAAACAATGTCAGG AACAAAATAAGTGCATGAGAACTGTGTAACAGAATTTATATTATTATCAT ACCATCTTTAAACCCATGTTTAAGTCTACACCCCAAAGAAAGGGGTTTCT ATCAACCTTGGAGGAAAATGATAACTTCACTATCTACAGTGGTAAAGTTC TTCAAGGCAAGGAGACAGGGACTGTTAAGCAAATCTAGTGTTCAACAGGA GAGGATGATTAAATCCACTTATATTTCTCATCACAACCATCACTAACCTG AAAATAGAAACTAAATGGACAACTGTAGCAGGTGTGAAACTAAAGAGAAG GACTGAAGTAGTTGGGGTATACAAGCAAAAATAATGCCACTTATACTTCT AGCTTATAATTTTCAGAGTGAAGAAGAACAATGAGCATGCCGAAAAACAA AATCCAAGTGCCTCTTGATGAAAGTGAAAGAAGAGAGTGAAAAAGCTAGC TTAAAACTCAACATTCAATAAACGAAGATCATGACATCTGGTCCCATCAC TTCATGGCAAATAGATGGGGAAACAATGGAAACAGTGACAGACTCTATTT TCTTGGGCTCAAAAATCACTGCAGATGGTGACTGCAGCCATGAAATTAAA AGATGCTTGCTCCTTGGAGGAAAAGCTGTGACAAACCTAGACAGCATATT AAAAAGCAGAGACAGCACTTTGCTGACCAAGGTGCATATAGTCAAAGGTA TGTTTTTTCCAGTAGTCATGTATGGATGTGAGAGTTGGACCATTAAGAAA GCTGAGCACTGAAGAATTGATGCTTTTGAACTGTGGTGCTGGAGAAGACT CTTGAGAGTGCCTTGGACAGCAAGGAGATCCAACCCGGCAATCCTAAAGG AAATCAGTCCTGAATATTCATTGGAAGGGCTGATGCTGAAGCTCCAATAC TTTGGCCACCTGATGCGAAGAACTGTCTGATTGGAAAAGACCCTGATGCT GGGAAAGATTGAAGACTGGAGGAGAAGGGAACAACAGAGGATGAGATGGT TGGATGGCATCACCAACTCAATGGATGTGAGTTTGAGTAAGCTCCAGCAG TTGGTAATGGACAGGGAAACCTGGCTGCAGTCCATGGGGTTGCAAAAGTC AGACATGACTGAGCAACTAAACTGAACTAAGCTCAACACAATGATGCACA CAAAATCTTTCCATAGATACTCTTAATAATGTACTTAATGAAAATTAATC TTAAATAATCATAGAAAAAGACTTTCCTATTAAATACATAGATTCATATT CTCAACAGAATTTTCAACTGAGAAAATCTACTGTCTACTGCATTACCTAT TTTATTATTTTATCCCTACTGTCCTGAATTTCTCTAGCCTAACAACATAA TTATCCACAACAAAGACTGATCAAATCATCATGGGTTATTTACCAGATTT TGCTTGTCTACAGAAATAGTTTTCTCTTTCCTCAGTGATCAATGGCTCCA CAATTGAGAATGAATGGATTTTTTCTCAACTTCATGGTTTTATGTCACAG AAATGATGAGCCTTTCACCAGAAACAACTTCCCATTTAGTCTTTTACAGT TACCTCTGTCTAGGGAGATCTTTTTTTTTTTTTTTTTGGACTGGAAAACA GTGTCTAAATCATGGAGGACAATATGAAGAGAAAGAGAACCCGGTTCGGT AAGGAAAAAAATAGCAAGGTCTCCTTCTTTCTACAAAAACATGTAGACTG ATATACATTTAAGCAAGATGCTAAATAATTAGCAAATCTAGTTTTATTTG GAGACCCTTTTTTTCCCTGGCAGTCGGGCCTATAGAAAACAGCATTAGAT AGAAAACAGGAAATAGCTTATTTCCACATCTTTCATTAAAATAAAAAGCA ATTGGTGGTTATACAGAAAAGTACATTTTAGGAAGCCTTAAATTCTATAA TTGAGTTTATATATGTTCAATCTCACCAAAAAATACCTTCTCAAAGAACA TTTTTTTTAAGAATATAAGCAGTAAAAGCAGAGCCTTCATTAGATCTCTC TAACATACATGCACACACAGACACAAACATATACACATTCTCAAGAAATA GAGAACAAAAGAAACACAGATATGGAAAATTCAAGCTTTCTCATAATGCT ATTGTGTCATGAAAGAAATCTGTCTCACTGCAGAATACAAAAATTGCTAT TGGAAGGTAAAGCAAAGTGAATCAAAATGTTAGTCACTCAGTCATGTCCG ACTTTTTGAGACCTCATGGTCTGTAGCCCATTAGGCTTCTCTGTCCATGG AGTTCTCCCGGCAAGAATACTGGAGTGGGTAGCCATTCCCTTCTCCTGGG GACCTTCCCAACCCAGGGATCAAACCTGGATCTCCTGCATTCAGGTGGAT TCTTTACCATCTGAGCCATCAGGGAAGCCCATTGGAAGGTAAAACATTAG TAAAAATACATGGAGATGGCCTCCAAAGCATCAACACATAAAATCACTTG GCCTCTACCTCACTATCAGCTGTAGAAATGCCAGGGTTTAATACATACAT TTTTATATTTAGCAGACATAGTAGTTTGGGGAAAATAAACAGCCAATATT TAAGTTTGAAAAATCAAATCAGAAAAATAATAAATCACTCTCCTTTTCTG CTCAACCTGCCTTGGCTTAGACTTTATTGAATTCAAACCAAGTACTGATG TATGTGTTTTTTCCTGTGAACAGAGAGAAAAGTAGAAAATAAGAAATTGT GTAGATCTATTTTTAGAAAGGAAGCATATGCATTTTCTGCTAACCAGTTT TTAGACAGAAATACAAGTGCTTAGAAAATGATGTTTGGGAATATTATAAT ACCTTTAAAACACAGAGAGTTGTTTAAAAAAATACAGGCTTTCTCATCTA TCTGATAAACTATGTCTTTTACCAAAACTGGTTAAAAATTACATTTGGTA ATTTTTTCCTAAAAAGTTCAAAGATATTTTAGAGACACAGAATATCTAAA TCATAGTAAGTTTAACAACTTTTTTGAGGTAAGTCATAATCATTCTTATT ATAAAGAAAGACAACTCAAATTAGGTCCGAGATAGTTGTGAAAATTAGAA TAAATTGCATTTAGATATTAATATTTGAAACCCTAGAGGAGCAATATTCC TTTTACAGAGAATTAATTTTTATGTGTAGAAATCCTGAGTGTGGTATCGT CTCTTCCTCCTTACAGATAATCTTTTTTTTTTTTTTAAAGCAATTAAGCT TTCTATGATTATACAGTGGAAGTCAAAAATAGATTTAAGGGACTAGATCT GATAGATAGAGTGCCTGATGAACTATGGGCAGAGGTTCATGACATTGTAC AGGAGACAGGGATCAAGACCATCCCCATGGAAAAGAAATGCAAAAAAGCA AAATGGCTGTCTGGGGAGGCCTTACAAATAGCTGTGAAAAAAAGAGAAGC AAAAAGCAAAGGAGAAAAGGAAAGATTTAAGCATCTGAATGTAGAGTTCC AAAGAATAGCAAGGAGAGATAAGAAAGCCTTCCTCAGCGATCAATGCAAA GAAATAGAGGAAAACAATAAAATGGTAAAGACTAGAGATCTGTTCAAGAA AATTAGAGATAAGAAGGGAACATTTCATGTTTCAACTAAAAAGCCTCTTG ATGAAAGTGAAAGAGGAGAGTGAAAAAGTTGGCCTAAAGCTCAAGATTCA GAAAACTAAGATCATGGTATCTGGTCCCGTCACTTCATGGGAAATAGACG GGGAAACAGTGTCAGACTTTATTTTTGGGGGCTCCAAAATCACGGCAGAT GGTGACTGTAGCCATGAAATTAAAAGATGCTAACTCCTTGGAAGGAAAGT TATGACCAACCTAGATAGCATATGAAAAAGCAGAGATGTTACTGTGCCAA GAAAGGTCCGTCTAGTCAAGGCTATGCTTTTTCCAGTGGTCATGTATGGA TGTGAGAGTTGGACTGTGAAGAAAGATGAGCACCGAAGAATTGATGTTTT TGAACTGTGGTGTTGGAGAAGACTCTTGAGAGTCCCTTGCACTGCAAGGA GATCCAACCAGTCCATTCTAAAGGAGATCAGCCCTGGGTGTTCTTTGGAA GGATGGATGCTAAAGCCGAAACTCCAATACTTTGGCCACCTCATGCGAAG AGTTGACTCATTGGAAAAGACTCTGATGCTGGGAGGGGTTGGGGGCAGGA GGAAAAGGGGACGACAGAGGATGAGATGGCTGGATGGCATCACCAACTCG ATGGACGTGAGTTTGAGTGAACTCCGAGAGTTGGTGATGGACAGGGAGGC CTGGCGTGCTGCAATTCATGGGGTCACAAAGAGTTGGACACAACTGAGCA ACTGAACTGAACTGAACTGAAGCTCTCTATGGGAAATCTGACAAGTTAGT TCTCTGCTAGACTCTCAGCCTAAAATCACTATGCTTACTTCTCTTTTTTG TTGCAAAGAAGACAAAGGATGCCTACTTTTACTCCAAATTCTTAACTTCA TTTCAACTCACAGCTGGAATCTTTAATGTATGAATTCATAAAAATGGGTT GAAGAATTAGCATTTGTATGACAAAACAGATTCATCAGGATAAAATCAGC CTTGCAGGGGTTGGGGGTGGGGGACAAGCAAAGAAATAAAGACAAAGATT TTAGAGATATGAAGTTCATTTGCTTATTTTTTAACTCAATTCACTATAAT CATGGATCCAATGCCAAATAAAGATTCCCATCCTCTTTTTGTGTCTATAA ATCTTTTAAATCCCTGAAACACACAATTGGAATGGAAAGAAATTTAGTAC ATTTCTGATTTATGAGATGTAATGTGATAAACACAATAATTTCTAAAGAG AAAAGATTAAGGTTTCTCTCTTTTTTAAGGATATTAATGTTTTAAAACTT CCAGACAGAATTCCTAAGATACCATTTGACATCCTAGGGGCCTGGGAGCA TGATTTCTCCTCCAAAAGTAAATTCTTTCACTGGATTCAAATTTCCTATT GCTCAAACTGATCAAGGAAGCAACTTTTCATTTCTGGAAACTATCATTTT CAATTTAATGATGAACTTGAAAGGACAGAAAGGTTGCAAAATGTGTGGTT AAGAATGTGTTCTGGGAACAGATCACCCACATGTAAGATCTTCCACCAAT TACAAACTACACAACATTAGGAACACATGCCAATTATAATCACATTGTGT CCCAGCTCCAAATCTACCCTCTTTGCTCTGCTTTGAGATAACAGAGCTGG ACTGTGAAAACATTTCTCTTTTCAATAGCTCATGCAATGGTTGGCTTTCT TAATAAAGAGCAAAGAATGACACAAAGCATGGCAGAACAAGGATCCTCCC TTTTTGGTTCCAGGGTACTTTTTTCTTGTTTTTGTTCTTAAACCATGACA ACCAACCTTATAAGACAATGCAGTTAAGTCACCCTTCAGTGAGTTTTGCA AGTATCTTGGTGGATAATTTCTTCCTTGAATACTAAGCTGTTAACAAAAT CTAGCCCACAGCACCCCAGCAGATTTCTCCAGATGGAAGAACACTTCCAA ATACACCTTCAGGCCAACATTACCCAAATACCAAAATCAGAAAAGGATGC CACAAGGGAGAAAAATAAAGGGCCAATATTTCTGATGAACAAAGATCCTC ATCAAACACCTCAATAAAAATATTAGCAAACCAAATTCAAGAGCACCTTA AAAGGTTTAAACACTAGGATCAAGAAGGATTCACTTCCGGAATGCAGTGA TGCTTCAGTATTTACAAATGTAATACACCATGTAACAAAATGAAGCAAAT GTGATATATCATGAGAACAGAATGAAGGATAAAAATCATATAATCATCTC CATAGATGCAGAAAAAGCACCTAACAAAATTCAACATCCATTTATGATAA AAACTCTCAACAAAATGGGTATTAACAGAATGCAGCTCAACATAGTAAAA GCCATATATGACAAGCCTACAATCAACATCATAATCTATGATGAAAGCTG AACATTTCTCCTCTAAGATCAAGTACAGGACAAAGATGCCTACACTTATC ATTTTTATTTAACAGTATTGGAAGACCTAGTCACAATATCCACCAAGAAA AATAAAATAAAGAGCATCAAAATCAGAAACAAAAAATAAAACTATTTGCA GATGACATTATAAAAGATTCCCCAAAAATCTGTTAGAACCAATCAATGAA TTGGTAAAGCTGCAGGATACAGAAACAATATACAAAAATCTATTGCCCTT CTATATATCAATAATGAACTATGAGAGATAAATTAAGAAAATATTGACAC TTAAAATTGCACCAAAAAAAAAAAAACCCACAAAGTATTAGGGAATCAAT ATAACCAAGGGGGTGAAAAACCTGGACACTAAAATCTATAAAACATTGAT GAAAGACATGGATGATGACACAAATAAATGGAACAATTTTCTATGCTCAA TGAATTGTAAGAATTTATATTGTTATAATGTCCATGCTACCCCTCCCCGC CCTTCACCTCCTCCCCCCCACCCCCCGCCCTGCCTATGAGGCAATCTACA GATTTAATGTAATCCCTAACAAAGTTTCAGGGGTATTTTTCACAAAAATA GAACAAACTATCCTAAAATTTTTATGGAACCACAAGAGACACCAAATATC CAAAGCAATCTTGAGAAAGAAGAACAAAGACAGAGGCATCTCACATCCTA ATTCCAAATTATATTACAAAGGTATCATACTTAAAACTATGTTATTGCCA TACATAAAAACAAACATGGATCAGTGGAACAGAATAGAGAGCCCAAAAGT AAACCCACCCATAGATAATTAATGTTCAATAAAGAAGGTAAAAATAAACA ATGGGGAAAAGATAGTCTCTTCAATAAATGGTGCTGGGAACACTGGACAG TCACATAAAAATAAAACCAAAGTGGGCCACTCTCTTTACACCATACACAA AAATTACCTCAAAATAGATTATAAACTTCAACATAAGACTTGAAACATAA AAGTTCTAGAAGAAAACACAGGCAAGAAGCTCCATGACAAAAGTCTCTGA AACACTTTTTCAATTTGACACCAGAAGCTAAGTCAACAAAAGCAAAAATA AACAAGCGGGATTACATCCAAAAGGTTCATCCCTGTTTCTGGTTCAGAGT TCCTAAAATCCTTGGAATTTCCTAAGTGTGCATGCGTGCATGCTAAGTCA CTTCAGTCCTGTCCAACCCTTTGCAACCCTATGGACTGTAGTCCACCCAG CTACTCTGTCCATGGGATTCTCCAGGCAAGAATACTGGAGTGGGTTGCCA TTCCCTTCTCCAAGGGATCTTCCCAACCCAGGGATCAAATGTGCATCTCC TGAGGTTCCTGCACTGCAGGTGGTTTGTTTACTGCTAAGCCACTAGGGAT TCCTTAGTATGGAGAATAACAAAGTTGTGTATTCTCATGTTAATTAGGCA ACTTTGGAGTGAACCTAAGGACAGAGGGCGGTTGCCAATGGAACCAAATA TGTGATTAGAGGTTGAAACTTCCAGTCCTACCCCTGACCACCGAGGAGAG GAGATAGGCTGGAGGTTGAATTGGTGGCCAATGATTTAATCAATCACATT AATATCTATGTAATGAAGCCTTCATAATAACCAAAAAGGATGGAGTCTGG AGAGTTTCTAGGTTGGTGAACACATGGAGGTGTTGAGAGAGTAGCACCTG GAGAGGACACAGAAGCCCCTTATCCTTTGCCCCCACTCTGTGTCTCTTCC ATCCAACTGTTGCTGAGTTAGATCCTTTTATAATAAACGGGTCATCTAGT AAGTAGAATGTTTCTTTGAGTTCTGTGAGCTGCCCTAGCAAATTAATCAA ATCCAAGGAGGGAGTCCAAGGAACCTGATTTAAAGCCAGCCCATTAATAA CAACCTGGACTTGAGATCATCATCCAAAGTACAGCAGAAGAAGGGGGGCC ATCTTATAGGACTGAGCCTCAACCTGCAGAACTTAATGGCATCTCTAGGT AGATAGTGTCAGAACTGAGTTAAAGGTGTAGGACACTCAGATGGTGCCCT GAATTTATCTGAAGAAAACAAAAACACTAACTCAATAAGATATTTGTGCC CCCTGCTCACTACCGCATCACTACAATAATGAAGAAAATGTGGTACATAG ACACAATGGAATAATATTCAGCCACAAAATACAAAGGAATCTTGTTGTTT GTGACAACAAAGATAGACCTTGAGGGCATTAGGCTAAGTGAAGTAAGTCT GACAGAGAAAGACAAATACCATATGATTTCATTTGGAATCTAGAAAACAG ACAGACAATAAAAACCCAAGGTCCTAGTTCAGGGAACAGATTGGTGATGG CCAGAGGCAGGGAATTGGGGATCAAAGGGTACAAATTTATAAGTCATGAG GGTGTAATAACATATAGCATGGTAATAATAATCAATAATATTATATTGTG CATTTGAAAGTTGTTAAGTGAGTAAATTTTTAAAGGACAATGGAGATCCC ATATGCTACAACTAAGATCCAATACAGCCAAATAAATATTTTGTTTAAAT AAAAGTTCTCATTATAAGAAAAAATTGTATAACTATGTATGGTGATATAA CTAGACTTATTTTCATGGTTATTTTGCATTATATTCAAATATCAGAGCAC TGTGTTGTATGCCCGAAACCAATATAATGTTATACATTAATCACACCTTG ATAAAAATATTTTTAAGATATTAATAACAAAAAAAGAAACCTTCTTCATT AATTAAGTAGCACGCACTTTACATTCAGCGAGTAAATATGTACCCACAGA TCTTAGTCGAGTGATTCTGGACTCTCTCACTCACCACAGTTAGCTTCCTC TGCTCCATCTGGACAGTCAGACGTGAAATCATGCACCCTGCTGGATGAAG TCCAGCCTGCGTCCTCAGGTGGCGCAAGTCCAGCTTCAAATTAAGAGATG GAGAGAATAAAACATCTTTTTCTCTTCCAACAAATAGATGGAATGTATAA TTGTTTCATGAACACTAGTTTTTAAATGGGCTAAAGATGGCAAGCATAGG GTCTCAATAAATCTCTGGCCATAAATATAACATAATTCACCATAAGTAGG ACTTGACAAGTCCCCTTCTACTCCCATCCCTAAACTCCTGCTTGGTAGAA ATACTAAAGTCCATGAAGGAGATCTTACAATTGCCTACTGGATAAATTTG TACAAATGGTAAGAAAGTTTTTTCCTTTGTGTAAAATCATTGGTCTTTCA GGAATAATTCACCTAAGTTTGGCCTAATGAGAATTATGCTCTAACCAACT GAGCTGGCGTGCCAATTGAAGCACACATGAATGAGTTTTGAGTTAATTTA TGAAGAGAATTCTCTGTAAGTGAGATCAAGTATTCTCAGAGAATTCTACT AGGGTTAATTTTACTGATAATTTCAAACTTTTAACCACTTCGGCTTCCAA ATACACTGCCCTCAATGTCAACTCTAATACCTTCCTACTATTCCAATTCT GGTGATGCAGCATTTAATTAGGAGAAGGAAAATATTTAATTAACTAACAG AAATAAGGTAATTCTGGTTAACCCTCCAAAACTCATTAATCATTAAATCT GCTGCTTTGCATTCTGTAATGTCTATCAACACCCCCTCCCCCTCCCCACA CACACTCACACTACACACAGCTTAGAATGGTTTATTGTAAATTCAGGACA CATATTCTGAATAATGTAAAAGCATGTTAACACAGTACAGTTAGGACATA GAATATACAGCCTCACCAATGAAAGATGCCTTTAATAAAGGATCTTTAAT GAAAAGTTCTTTAACTCAGATCTCAATTTAAAATTGTTTCTCCTATATCA TCCTTGATTAATGCACTTAGCTCCTGTTAAGAATGCAACTTCTCTCACTA AATATGTCATATAAGAAAACATAACTTCAGAATGTATGACATGCCTGATG TCCACATGCAATTATTTTTTATGTAAAGAGATTAATAAAATGAAGTGTGA CAATTTTCAGAAACATTTTTAACATTCATTTTTGTTTCTTAAGTGAGACC TGAGGAAAGGGGTGGTCAGAGAGAAACATCAACCAGTGTTAAAATAACAG AGTAACTGCAGGCACAATATATACCCGTTTCAACGTGCTCTCACAAAGAC TCCATGGACTATAGACCCCCAGGCTCCTCTGTCCATGGGATTTCTCAGAC AGGAATACTGCAGTGGATTGCCATTTCCTTCTCTAGGGGATCTTCCCCAC CCAGGGATCAAACCTGAGTCTCCTGCATTGGCAAGTGAATTCTTCACCAC CGAGACACCAGGGAAGCCTGTATATTATGGAGAGGTTTTCAAAAATGCCT ATTCTATTATTTGGGATCCATTGTTATGACAGTATATCTTTCTCTCAATT GAAATTTTCTACAAAATATGTAGTCAAAGAATTAGTCAAACTCCATCTAT TTCTTGAAAAAGTTGTTTTGAATTTAAACACATAATTTTAGGGTCAATTT TGAAATTCTTCTTTGGCCTTAAGTCACTTTTCCAAACAATACTTTTTTTG AACTCCTGAGTGATTCTGAAACATGAATTTAATTACATATTCACTTGAAG TATCAAACAATATTAAAATACAATAGATTATTAGAGAGGTATTTTAAAAC ATGCAAAATATTTAAGATTCTTTCATAACTATTATAATTAAATAATCTGT ATGTGACAATTTTAGCCACAAGTGTACAATGTTATTTTAGATAGCCTCAG CCTAGACTGTGATAGATCGTATTTTTACCTTTTTCTTTTAAAAAAAAGAA ATGTTTTAGTTTTCATGGACATGTGACATAATACACATCCTGGTATTAAT GAACTATATTAATGAAGTATTCTAATATATTTTATATTTTGAGGGACTTT TCTGGTGGTCTAGTGGTTAAGACTTTGCCTTCCCATGCAGGGGGTGAGGG TTTCATCCCTGGTCAGGAAGCTAAGATCCCACATGCCTTGCAGCCAAAAA CCAAAACAGAAAAATATTGTAATAAATTCAAAAAAGATTTTTTAAATGGT CCATATCAAAAACTTAAAATGTATACATATATTTTTATATTTTGGTATCA AAGAAAACCATTTTAATGTTCAAAATTGCAACAACCATAAGAAAAAAAAG AAAAAAACTTACCTTTGCTTTGTACACTAGTACCTGGAAGTGTCTTATAT GAAATTTCACATTCCTGGGATACACTGATGTCATCTAGAGCAACAGTAGC GTTTGATGATAAAACTGTAGCTTCCAAAATTAACTAAAATTACAGAAAGA TAAATTATTAGAAATACACTATAAACATTTTTTTTTTAATTTCTAGACCC AAGATAGAGCCATTCCTGCCCTGGGCGCCATGACAGCAAATCAAAACTTA AGTAACTTTCATGCCTTTAAATGTTCCTCTTCACCAGAAACACATTATAT TCAGTCAGTCAGTATCCAAACTTCAAGCCAACTCTGGGCTCTATATTTCC TTATTCCTTCTCAACCCAAACAAGGTTGACTGTGAGGCCTCAACCAACTG AATATTTTCTGTTTTATCTCTTCCTCATTTTTTATTCTTTACCCTATAAA GCCTCTTGCCTTCCACCCCATTTTGCATTTCTTCAAATTAGAGACTGTTT CTTGAAGTGTTGAATAAACCTTGTTTGTACCCCCTAAACTATCTTCCTTA ATCATTTTTTAACAAAAGTAAATGTATTACAATCATATTTCTTTGTGTAG AGAAGCTTATTTGCATGTGTCCCAATCTTCCAACCTAATTTTAGAAAATT GTTTTGATCAGAAAATTCAAATTAGGAATTTATAAAGTCATAACTGCTTT GACAGCACCTTATGCAACCTTAATATCCTAGGTAACCTTGTTTCAATTAG AAGTTGCAACATTCATCACAACTGAAGGGCCACCTTCCCACTGGAGCCAT TAAGAGTTATAAGCATTTAAAATGAGCTCTTTGGGGTAATCAACTGCGTG GTTTACAACTCAATTTAATTGAGATATGAGTTCATTTATAATGTGTCTGC TGAAGGCAATGATTCATTTACATATCAGAATATTTAAACACTTATGTAGA TTACATATACATATATGGAAACCTACTTAGGCAAAAAACCACTTACAACG GTTAATAACATTCATATGCTAAAGCACTTGGAGGCACCTACTTAAGTTTA ATTTATTCTAACTTTCTAAACAATGACTAATATAATTTGTTTTCTTTCTT GTTAATCACTCACATTATGTTGTTATTCCACCATCTTAAAAAAAAAAAAA GAAGAAGAAAGAAAGAAAGAAAATATATATGTGCAGGGTCTTAACAACAC AGAGCAGGACAACTAGTCCAGGCTAGCAAGTGGCTAGTAAGTGCATCTCC ATGTTATCAGGGAGGATCTCTGAGCTCAAAGACCTTAAAATTAACCTGGT AAGACACATTGACACCTAAACTATACCATAAGTACTATATAAGAAATATG CATACGATACTAAGAGAATCAAAGAAAAGCACTTCATTACTTCTGCCAAG AATGTGAGACAGAATTCAGAAAAAAGTTTTAGTAGAGAGGTAATACTAAA CTTCAGTTTTAGGTCACCTACACCTTTGCCTGCTTTCCTCTATATAATTA AATGCAAGACTATGTGATGAACAGTTACAATTTGATCTAGATTAATTAAA ATCCTCCAATTTTAAGTAGAGAAAAATGTTAAAATTCCTCTAAAAATATA TATCTCATATCTGTAAATAATATCACCTGATTGTGCCCAAATCATCTTCA CTGTTTCTATTTAGTATTACTTGCTTTAAACCAAGCTCATCTTTCAATTC GTCACTGAAGGTAGCTCCCCACTGAGAACTACAGTATCAGTTAATAACCA CTGTGTGAGCCAGAGGTTGCTCAGAAGAAATGCTTCAACCATGCAAAAAT GCAGAGAGAAAAACCTAATTTTAAGAAGATTCTGAAGGTAACTTGAGAGC TAAAATTTCTAATTATATGTAGATATCCTTCCTTCTAAAACTAATTTTTA GGATCTTGCTGAGTTTTGTTTTATTCAATTATATTATATGACTCCCTGAG TGAGCAGAATGAATTCTTGTTTTTGCTTTCAGGAAGCACGGCAATGGTAA ATATTGTTTACAGTCAAGTGATTACTTTTTACATCTGCAAAACTGAGAGA AGGTTTTCCAGAGAAATATTAAACTAGCATATTTAAATTTTGGTTTTTTG ATATCTTGTTTTAAATAAAGGATAATGAGAATGAATAAATATGAATCTAA GGGGAAACAGAGACTATGGGAATATGGTAAGAACAAATAAAGAAAAACTG GACTACAGTAATTTTTAAACAATGATGGTGGTGTTAAAAATAAAATCAAC AGCAAACTTTTACTAAAGAGCTTGGATGCTTTTTTTTTTTTTTTTCTTAC ATGCCAGGCCTGGAGTAAGCTAAATAAGTTAAAATGCATTCACTTATTTT AACCCTATGAAGGCAGGGCTACTTTTGTTCACATTTTAAATCAAAGGAAA CAGAGCTTAGAGAGCTGAAGTTATTGGTTGAAGGTCACATTTTGAGTAAG AAAAATGTGTAACCTAAGCCATGGATGATTATGCTGAACATCATCACTAC CATGAAATAAGAGATAACTGGTCTTCAGAGATGCTGGAGGACACAGCTAC CTGGCAAAGAAGATTTAATGACGCCCTGGACTAAGAAGGCCAAGGACATA GCAACATTACAGAGACCAGACCAGCTTTTACTTTGCATTATAAATCTTAC CCTTCACCGAATCCTCAAATAACGTCAGGAAATTGCTATTGATTTATACC ATCAACACTGATCAAGAGTGAAAATTATTGTAGAAAATTTCACAAAAGTG TCATCTTAAAATAAAATCTAAATATGACACGATTATGTTTTAGTAGCAAA CTCAAAGACAGCAGGTCAACCTGAAATCAATAAACAGTATTCAGAAAAAG TACCACTTCTAGATATGAAATTAAGAAGAGTTAGGAAACAAATTGCAAAT TAAGTGGATATATTTGTGTAAAAAGCTGAATATTTAAAATGAGTAGGAAC AGTTAAAACAGATCGGAAAAAAAAATACTATTAATGTGAAATATGTGACA TACGTTCTTCCAATAAAAACTGCAAAGGCAATGGAGAGAAAATTAAAATG CTAATTTGCTATTCTTGCAAAATAAACAGTAAGCCAAATTCACTTCTACC AGAAGACTGAAAGCCCTACCTACCCAGGCACTGATTTCCTAAAGAAATCA GAGCAATTTATATTCTGTTGCGATGTGTACAAGAGACATAAAAGGACCAC ACTGAATCTGAATGTCATGGCTACAAGAGAACGGAGAGGTCACACGGTCC CGTGCCTTTCTCCTTTCCAACGTTTGGATTAGATAACTCTCTACAAATAT ATGCTTAGCCGCATTATACTGATGGTCAGGCAATGAAGAAGGTCACCCTT AAATACTTCAGTCCATTAAATTTAAAGTGCCAAAGGAGCCTGTTTCCAAG AAGATAAACTTTAAATATTTGAATATGTAAGAGCTAGATTGACTCTTTGT AGGTATAACATCTTTTCCGTTTGCTGTTGACCAAAGAATGAAGTAGAACT ACATCTAGCTAGACTCCTCACACATATTTCTGTAACTTTGAAAATACACT TAGAAAAATCAGGTTAAAAACAACATAATTTTAGCATTTTTGTTGCTTGT AGAGGATAAGAAATGGAGTAGAGAGGGGACCCAAGAAGAATATATCAACA TTAAAAAGCAAACGAAAATGTTCATATTAAATTCATTCTGAATTTTAAGT ACATGGGGTGTTGCCTTTCTGTGTACTTTCTCCTTGTTTGAAAGGTTACT AAGGTATCTAAATAATATCAATGGTATTCAATAAAAAACTGGGAATGTAT GGGGGTGGACTGGGTATTTATTCTTTCTAAAAAAAGGGGGAAAAAAATCT GGCCTGGAATCACCCCCAGGAAGGTTAACACCAAACCCCCATTCCCTTTC CCCCCAGGCCCTTTGAAGTCCCCACTAGGGAATTTTAAATACCTGAAAAA AGGTTCTAGAAAATGTGGGGAGAAGGGTCCCCTCTTTAAAAATGGATATC AGGGGAGTCCCCCCTCCAAAAAAAAAAACCACCGAGAGGGGCGGCGCTTT TCTCTTTTTTCCTTCCCAAAACACCCCCCCTCTCCACAAAAAAAAATGT project fbnr AC 20040903 23300bp GGGGGGAGAGGGGGGGGGGGGGGGGCCGATGACTGCAGTAGTTCATCAAA TCGTTACTACAAAAAAAACAAGAAAAACTGGAAATCTTTTCTTTAGAAGG AAACAGGTGAGGGATTTTTCTGCTACAGTTTGTGATTACCCTTAAGCTGT TAGGAACTATTAAACACAAAGTGCAACGAAAAAGAAGGATTCATTTATAT TTGTCCAGTTTATCCTTAGGACACCTATGGACTCACTGCCCTTTCTTTGG CTGTCTGGCAGAAGCCATTACTATTCTTTGAGCAGCAAAGGGAAACCACT TGGCTAGTTTGACCAGAAGTGCAAAGTCCCTTCCATTAATAATCCCTCTG AAGCTTCCTTTAGCACGATTGCTCTGATAACACGAGTGGTTCTGCTTTGA GGAAAAGGTTAATGCGAAAGAAGGGGAGAGTTGCTGAGCAGAAAAGATCT GGCTGCATGAAAGATTCTAATAATCCCAGAATGAGAGAAGCATGAAGGAG CAGATCTGTCAAATAAACAGATTTCATTTTAAATGTTACCCTGGGGAAGT CACCTCTTGGCTTTTTCACTTTTCATTTCTGAGAAGTTCCACTTTGGTAT TTTATTTAAAATGGGATAGCCGTAGATAAAATTGACAATTACTTTTAAGC ATGAGTTTCTTTTGTACACTAGAGGGAAAATATTGTGGAGGAATCATGAT AGCAAAGCAGTTTTTCTCTTGAAAATTTGCAATACTAAACTTACAGACAA GATTTTTTTTTTTCCTAAAGCTAACTTTATTATGATGTTTAAGCAATCAC ATTTTGGGGGAAAAAAGCAATTTGTGACCCTCATTAAAGTCCAAATAATG TAAGCTCTAGAGAATGGATTAATATAATTTTTTTAAATGAAATTGACATA GTTAAAATTCAGATGCAACTAATTCTATTAATAATTTTTTGAAAAATTTC TTATTTTACATGATGGTCCTATTTTCAGAATATTTAAACGTATTATTTTA ACTCAGTATTTTTTTAAGATAGTAAATTTAGACAATCTTCAGAATGAAAT AAATTCTGTATACATGATATTGAGCAAATAAATTTTGAGCAAGAAAAATA ATTTTTAGGTGTAACAATGATATGTTTTTAATGTTGACAAGAACTTCCCT TTACTAGAATTTATTAATATCCTGAGCCAGGGAAATAAATGTTGTGGTAC TGCTCTGCTGCTAAGTCACTTCAGTTGTGTCCGACTCTGTGCGACCCCAT AGACGGCAGCCCACCAGGCTCCCCCGTCCCTGGGATTCTCCAGGCAAGAA CGGTGGAGTGGGTTGCCATTTCCTTCTCCAATGCATGAAAGTGAAAAGTG AAAGTGAAGTCGCTCAATCGTGTCGGACTCTTAGCGACCCCATGGACTGC GGCCTACCAGGTTCCTCCGTCCATGGGATTTTCCAGGCAAGAGTACTGGA GTGGGGTGCCATTGCCTTCTCCAGTGGTACTGCTCTAGGTATTTTTAAAT TATGTTTCTCGTGTCACATTGTCTGCCTCCCTGCAGTACCCCATTGCCTG GTCTTCCTCATTCTATTAAGTTTTTATTAGTTTAATTAAACTAAGCCATA GTTTCTCTTTTAGCAATCATGCAAAATTATTTGATGTCCGAAGGCTTTAT TGTTTTACTTTTACTCAGCATCAAAACAGTAATGTTACTTATGTTGCTAT CATTCAGATAACAAATCAACCATAAGATAATAAACTATACTATTGATACA ATGTTGAGGTATATCCCATGCAGTGGGTCTCTACTACTGGAATACTGCCA GAAAATATTCTTAGATAATTACTTGAGCATACCTGAAGTTAGTTTTAACA TGAACTGTTTAACATTTAAACATTAACTGTTTAACATTTATGTTTAGAGC TAAATTTTCTGTGTCTAAAAAATGGAAAAATATATTCAGTTATACAATTT CTCATACTTACATGTCTTGCTTAAGAATACTTCCATTTGGCCTCTTTTGT TTACTTTGATATGATGAGATATATCATAAGTTTTAAAGTATTACCTAACT TCTTTTGCAAACTTTTTGAATTTAGGAATTTTTCAAAAGGTATTTACTTC ACATAAATCATTGTATGTGAAATGTGTGAAAATTACCTCAGAGGTACATT CTGAAAATCTGAGAGGTGATAGTGTTTATTCAGATGATATTAAGTAAAAA CATTGTTTCTTCAGTAGGATGACATAAATTTCAACTATTTTTAAAAGTAA TTGTAATTGTAGAAGTTCATTGAAGTATTTGAAGATAAACATTAATAGAG TGAAATGTGAGTCTTCATGTGCAGTATTTATCTTACCAGTACATTGAATG CAAAATGAATTTTCTCTATGCAAGAGGGATAACTTTCTATTAAAGATCCC ATATTCACCATTACAGACAGCAGTGAAAAGTGAGAAGATCTTTTGGCCAA ATTGCTGCTCTGAAGTAGAGAATTGCTTGTAATCAGCTATATAACCTTTA TAACACTCACGTAATATTACTGCAGGCTGGAGGAAATGCCACACATAGTC AGTAATTCTGTAGAAATCACCAGACAATTAGATACAGAGAATTCCTTTGA ATTTTGGTAATCTTGAGTAACATATTACAGTTAAAATAATGATTTGGAAA TCTTTTTTTCACGTGTCACTGATGGTATCTGTGTCAAATTCTTGCCGATT GAGATTAAAGGCAACTATATGACAAGATTCCAACCTAAGTAACATTAGAT AATTCTGGTGTGAGCTATGGAACTTCTTATTCCATTTGCTATCACATACC TTTCTGAATTAGGATTTTTCCTATTTTTGTCTCATTGAAACTATTAAAAT TAATTCAGTGTGAAGTATAATCATTTCCCTGATAAAAATTAATTAATGGT TTCAAATTGCCCAGCCAAATAATAGCCCTCTTTCATGGAAATTTACTTTT GAGGATAATTAAAATTTACTTTTATTTAATTGGAATATTTTGAATGTATT TTTATCCTTTGCAGGAACTGGCCATTAATTTTTAAATTAAATGAGAGTAA GGGAGATAATTCTTTGTGAAAATTTTTTATATGCTATCTACATGAGGGAA ATCATCTAAACATTAAAATGTATGTGAAAGTTTGTGACTATGTAATACAT AGCTTTCTTCAAAAAGGAATGAGATAAAAACACTTAATCTTGGACTAGAA GGAAATTAACCTTAACACACTAATGGCTATATATGAAAAATCCACAGCTA ACATTATACTCAGTGGTGACAGACTGAAAGCTCTTTCTTTAAGATCTGGA ACAAGATAAGATGCCCTCTTTAATCACTTCTGTCAGCATAGTACTAGAAG TCCCAGCCAGAGCAATTAGACAATAAAAAGAAATTAAAGCCATTAAAACT GGATATGAACACAAAAAATTATCTCTGTTCACAGAAAATGTGATCTTAAA TGTAGAAAATCCTAAAAAGTCTATGAAAAAAATGTTAGAACAAAGAAACA AATTAAGACACGACTGAAGCGACTTAGCAGCAGCAGCCAGATTCAAAATC AACATACAAATGTTAACTGCATTTCTGTACACAATGAACCATCTAAAAAG GAAATTAAGAAAAAATTCCATTCATAAAAGGGTAAAAGAAAATAAAATAC CTAGGAATAAACATAACCAAGGATATGAAATCTAAAAATTGTTGGCTGGA AGAAATTAAAAGAAGACCCAAATAAATGCAAAGACATTTCATATTCAGGG ATTGGAAGACTTATGAGTGTTTAGAAGTTAGTAGTACCCAAGTATCCTCC AGCAGATGAATGAATAAATAAGATGTGGTAGATACATACAATGGAATATT GTTCAGATTTAAAAAGGAAGGACATTCTGACACATGCTACAACATGGATG AACCTTGAGGGCAATTATATTAAGTGAAATAAACCAATCACAAAAGGATA AATATTTTATTCCACTTTTATGAGGTACCTAGAGTACGCAAGTTTATAGA CAGAAAGTAGAATGGTGGTTTTGAGGGGCTGAGGGGAGGGAGGATGAAAA GTTTTAGTTGGGGGAAATGAAACAGTTGTGAACTTGAAGGGTGATGATGG TTGCATATTAGTGTGAATGTATTTGTTTTTATTTTTTAATTTAATTTTAT TTTTAAACTTTACAACAGAGCTATATACTTAAAATGATGCATTTTATGTA TGTCTTAGCACAATTTTTTAAGAAAAGCAGGATTATATCATTAAGGAAAG ATTACAACTCTGCCTCCTAGATCTTTCAAGAGGGAAAAAATGTGCATTAT TAATATAGGCCCAGGCAAAACTGTGAAATAAATGCCTTCTACCTCTCCTT TTAAAAAATTTCTTATTCTTATATTTTCTGTTTTCTAAGAACTTCATTAT TGTGATGACCTACTCATACTAAGTTAATCCTGAATTCTGCATCAATTTCT TCACCATTACCACTATTAAATTTTTTTAAAATTCCTTTCCATTTTCTCAG AAGCATGCCCTATGTTAACTATCACTTGAGGATATTTTAAAAAATATTTT CCCCAATTACGGTGTTAATGATCACATCTTTGAATGGCTCTGCAGTAAAA TTTTAATGAGAGAATCTGGCATGGTGGAAGCCAATTCAGAAGATACTCGG GTCTTCCAAGCAACCTCAAAGAACAACATAGAGACAGTCTCTTTTTGATG ATAGTACACTTGACCTGTGGTATCACAAAATTAAAAGCAAAATGAGGAGT TTCTCAAGTTCAGAAAGCTCAGGAACATGATTCTCTGGATAAGTTCCTGC GTCCATTCTTTCTTGTTCCATATCCAGTCCAACCGCAGCATTGCTATAAT AGCAGATAAATCTCCACACAGATTTTACTATAGCAAGTACTGTCAGATTT GAATGTAGATGGGTGGCATATGAGATTATAAAAGGCAAATCAACCACAAT TCAAGAAAAATTGTTCAAATGGCTTAAAATGCTCAGTTCTCTATTGGGAG AAAAACGAGTACTTAGAAAATTTTCTGATGGATTTTTTGAATAACCCAGC AGTTATGAGATGTTCATGATTGCTTCTTTTTAATAAGAATGAGTTGAAAA ATGTATGCTCATTAGATTCATGCTGTAACGAAAAGAATCCCTGTTGAGAC TATTCAGAAATAAAAATGTTTTATTTAGCTACTTTGTAGCTCTAACAGTT CAAAATACATCATCGTTATCCTTGTTTATTAAAGAGAACAAAAACATTGA AAACAAACATCAACTAAGTAATTTTAACACAAGGTAATTTCTTGGTATTT AAAAACTGACACCTATGTGAGAATGTGAGTATATTTCATACACATAATTG TTGAAATACAGTGATAAAATTACTTTTGTGAATATTTTGTAATCAGAAAT AGATCATTGGAAACATTGCTTGGAGCTGAAAGAGACTTAAACAGATACAT ATTTATGCAGGCTATTGCATAGCTATTTGAGTGACACACATTTATATACA AATAGCATATAATTTAGTTCATTTTCTGTTCAACTAGATTCTTGGATCAG TAGGAGTCCATGAGGTAATAACTCAGACATTCCAGCAATTCTAACCATTT TAAAGGCCTTAAGGCAATTGTAAATTTAATCATAGTATGATTCATAAACT AATCAAGTTTCCTAGTTTTTAGGTAGAAGGACATTGCTTCTACCTGGAAA TATTGGTTTCCTCAGTTTGAGTAGAAACTCTGACCTACCTACCAACCTTT AATTCTAAGTATTTGGTAAAAATGGGTTAGTGGATTAACAATGAGACCTT AGAATTTTAAGAATTCAGGTTTTGGAATCAAAAAAGACTTGGGTTCCACT TTTGGCCCCAGCATTCACTTGCTGCCTGCTTTGTAAGGTTGTTGTAAAGA GTAAACTGCTAGAAGTAGAAAGCCTATCACTGACCTTCCTCAGTAAATTG TACCTAGAATATTCCTGTTAATATTACAGAATACAGCTGCTTTGTAAAAT CTTTCAATAAGGAATCTAGGACTAAAATTAATAAAACAGACCATTGATAG TAAAGCAGGTTGTGGCGGATTCATTTTGATGTTTGGCAAAACTAATACAA TATTGTAAAGTTTATAAATAAAATTTTAAAAAAGTGTCATTTCTAAATTG GCTCTTAGTACTCACATGGATGATCACAAGAACATGCACCAGATGTATTA CTAAGTAATATTTTGACCAAAATATGATTAAATAAAAATTAGGTTTTTGT GACTGGGTTGCCAAGCACTGTCTTATCTATTAGTCTGAATAAGCACTGTG GCTCATGCAACCAGTCAGGACAAGAACAAACTTGTCAAAGGAAAATCACC GTTACTAAGAGCTGCAACCCAGGGATGGTATATTTGTGGTTGAATTAACC TATTTTTTAGAGAGTGACATTTGCAGATGTTGGATAATGGAATAAAGACC ACTCTGGATGATTATCACAAACAACCAGGTGTCCAAACCCTTTTGTTTCT CCCAAGCCTGTTGGATCACTTGTACCCAGAGAAAATGGAAAAAAAAAAAA AAAGCCAGAAAATACCCTTTTTTGTGTGTGATTAAAATACATTGTATCAT TTGATCTTCATAGAAATCATTCAAGGGAGAAAGGACAGGATATCAGTATT TTAGTTTCATAGGTGAAAAAAAGGGCTTGGTGTGATTAAATGGTTTAGCT AGGCCTTCAGTTAGTAAGAGACAAAATCAGGCCTAGGTCCTCAGTCTTAT GACCTCATGTGTGACATTCTGTCTGTATGACCACGCTGGTTTTTATGTGT GGGGATTTATTTGAATGTCATGTGCATAAAATCTTTGCATCGATAAAGTA GACTGAAATTGTGAAAAACTATCCAGCTGTTAATCTCTATTTCTCATTTG TTCCTAAGCTTTCTTTTTTCATGTATTGTATTATTTCTTAAGAAGACACA TAGGGTTTTGGAAGCTAATTTCTTTTCTCTCTCATTAGGCTCGGATTATG AAAGATGTGATTTTGAGGATGGGCTTTGTAGTATGATACGAGATCAGAGT CTGCGACTTGGCTGGACAAAGAGGAATGGGCTGATCGGCCAGTCACCTCC ATTTTATGATCACAATGGTGATATGTCTGGTAAATGCTTTGAACTTTATT ATTCATTTTTGTCAAACGGTTAGGACAGTTAAATCTTGGCTGATATTTAG AGATTATGATTATAATGTCTAATTTGATATCTTCTTTAACCATATTCAAG ATGTTTGTGATTCTAAAGTGTCATATTGTTGTTGTTATCTGGTTGCTAAG TCATGTCTGACTCTTTGCAACCTCATGGACTATAGCCTATCAAGCTCCTT TATCCATGGGATTCTCCAGGCAAGAATACTGGAGTGGGTCACCATTTCCT TCTGCAAGGGATCTTCCCGACCCAGGGATCAAACCCATGTCTCCTGTCTT TCAGGTGGATTCTTTACCACTGAGCCACTCAGTATCTAAAATGTCATATT AGATACTTATAATTGGGTTCCTGAGATCCCAAAGGACTGTATAGATAATT GGGATTTTCTAGCTATTTTCTCTATCTGAAAACTGTGAAATTTAAATGTG ACAATCCTACATAAATTAATTTGTCAAATATCTTTGCTTTTGGCTTGACT GATTGTAGTGATGCTCATTTTCTTTGACTGCCTAGAAAGCACTGATGGGT TGACCACTGGCCTTTGAGTTGTCTCTGGACCCAGATATTTATTTGTTTTA TTTGTTAGCTAATGAATTCCATTCATTCACCATTTTATACCAGGCAATTA AGATATTTTAGGGAACAGAAATTGACCCTGTGCCTGCTTTCATTTGATAG CCTTATACGTGATATGGAAAGAGGTAATCTTTTGCCTGGCATAACTAATT GAAGGCTGGTAATTTTTTAAAGTTTGTACTTCTCTCAAATAAATACAATT AAATGCTATATATGAATGTTTCCCTGAAGATAACTTTTTCTTTTTGGCTG CACTGTGCAACTTGTGGGATTAGTTCCCCAACCCGGGATCGAACCTGGGT CCATGGCACTGAATGCCCAAGTCACAACCACTGGACCACCAGAGAATTAC CTGCTTAGAGATAATTTAGAGCAATTGCATATTAATTGTTTGGAAATGTT TACATAAATAGTATACATGTGGTTGGAATCCCAGCACTGACACTTACTAA CTATATAATCTTGAGCAATATACTTTGTTAAGACTTGGTTTACTCAATTC TAAAATCTATCTTGGATCAGATTTAAGAGCTAAATAAGATATTTTGAGTA GAACTTGTCATAAACTATCTGATACAAAGCTGGATGGCAAGAATACACAG AAGAACTGTACAAAAAAGATCTTAACGACCAAGATAATCACAATGGTGTG ATCACTGACCTAGAGCCAGACAACCTGGAATGTGAAGTCAAGTGGGCCTT AGGAAGCATCACTACGAACAAAGCTAGTGGAGGTGATAGAATTCCAGTTG AGCTCTTTCAAATCCTGAAAGATGATGCTGTGAAAGTGCTGCACTCAATA TGCCAGCAAATTTGGAAAACTCAGCAGTGGCCACAGGACTGGAAAAGGTC AGTTTTCATTCCAATCCCAAAGAAAGGCAATGCCAAAGAATGCTCAAACT ACCGCACAATTGCACTCATCTCACATGCTAGTAAAGTAATGCTCAAAATT CTCCAAGCCAGGCTTTAGCAATAAGGGAACCGTGAACTTCCTGATGTTCA AGCTGGTTTTAGAAAAGGCAGAGGAAACAGAGATCAAATTGCTAACATCC GCTGGATCATGGAAAAAGCAAGAGAGTTCCAGAAAAACATCTATTTCTGC TTTATTGACTATGCCAAAGCCTTTGACTGTGTGGGTCACAATAAACTGTG GAAAATTCTTCAAGAGATGGGAATACCAGACCACCTGACCTGCCTCTTGA GAAATCTGTATGCAACTCAGAAAGCAACAGTTGGAACTGGACATGGAACA ACAGACTGGTTCCAAATAGGAAAAGGATTACATCAAGGCTGTATATTGTC ACCCTGCTTATTTATCTGCAGAGTACATCATGAGAAATGCTGGACTGGAA GAAACACAAACTGGAATCAAGATTGCTGGGAGAAATATCAATAACCTCAG ATATGCAGATGACACCACCCTTATGGCAGAAAGTGAAGAGGAACTCAAAA GCCTCTTGATGAAAGTGAAAGTGGAGAGTGAAAAAGTTGGCTTAAAGCTC AACATTCAGAAAATGAAGATCATGGCATCCGGTCCCATCACTTCATGGGA AATAGATGGGGAAACAGTGGAAACAGTGTCAGACTTTATTTTTCTGGGCT CCAAAATCACTACAGATGGTGACTGCAGCCATGAAATTAAAAGACACTTA CTCCTTGGAAGGAAAGTTATGACCAACCTAGATAGCATATTGAAAAGCAG AGACATTACTTTGCCAACAAAGGTTCGTCTAGTCAAGGCTATGGTTTTTC CAGTGGTCATGTATGGATGTGAGAGTTGGACTGTGAAGAAGGCTGAGCAC CGAAGAATTGATGCTTTTGAACTGTGGTGTTGGAGAAGACTCTTGAGAGT CCCTTGGACTCCAAGGAGATCCAACCAGTCCATTCTGAAGGAGATCAGCC CTGGGATTTCTTTGGAAAGAATGATGCTAAAGCTGAAACTCCAATACTTT GGCCACCTCATGTGAAGAGTTGACTCATTGGAAAAGACTCTGATGCTGGG AGGGATTGGGGGCAGGAGGAGAAGGGGACGACAGAGGATGAGATGGCTGG ATGGCATCGCTGACTCGATGGATGTGAGTCTGGGTGAACTCTGGGAGTTG GTGATGGACAGGGAGGCCTGGCGTGCTGCGATTCATGGGGTCGCAAAGAG TCGGACACGACTGACTGACTGAACTGAACTGAACTGAATAATTTTGGTTT TCCTAGTTTTAACTCTCATGTAAGTAAAATGTTTATCTTCCTTGACTTTG ATGACAAAAATAAGTTTTAAAAAATAATTTTTAACCATTGTTAGGAAAAA GCCAACTTTTTCACCACCACCCTTGCTCCCTACCCACCAAGAAAGACCAG CTTCACAAACAGGACCAGTGATTCACGGCAATACATAAAAGTTTTATTGT GAATTCAATTGGACTATATGGTGACACTGAATCTGGTTCCCAGATTTTAG CCACTGTAATACCGTTTCCCTTTTAGAACCTCCCCACCATTTCTTCCTTG TACTTTACAAGATTTTTTGCAGTATACTTTTACTTACTGCAGTCTCCATC ATGGGCAGAAGACTTGATACTTTGATTTTATGTCATATGTAGCTCTTACT CTTTCTTGCTTGCCTCTTCATCTGGAAGTTAGACAACATCAGAATCTCTG CCTCTTTTCTGTTCTCCTCCTTTTTATCCCTATTTCTTTCCTTCCTTCCT TCTGCCTATTTTCTCATTTTGCCATGCTAATTTTTTGATAGCCTAGTCAA GGGATAAAGTGGGATCATTTATATCAAAATTGAGATGTTATACAGGCAGA CACTGTTTTTATCTGTATCACTTGGTTTGACTCCAGATCTCTGGAGTCAG ACTTGTTGGGTTTGAACCCTGGCCCTGCTAACCTGCTTATTATGTTGTTT CAGTGTCCTCATCTGTAAAATGGAAATAATAATATAAGCCAAAAAGGGAA AAGGAGGCAAAATTTTGATTAGCATAGTAATGAAAGGCTAGTGATTTTAA TAACAGTGATGTGTCTCATAACTACAACTAAATATTAAAATATGTGTTTT TCCCTAGAGATACTTTTAAATAAGCAAATGTTTTGCCTTCAGATATAAAG TGTTGAAAATGTTTATGGAAAAAAAGCTATGCCGAAATCTTGTCTTAATT AAAAAATCCTTATTTTGTGAGTTTTAATAAAAATTTTTTTATTAACTTAC ACTTGAAATAATTTGCCAGTGCTCCAGATTAAGTTTCATCATGTAATCAA TGCCTAGAGAAGTTTTCTGAGCTAATTTTGAAAATCTGTTAGAACATTAA AAGCATCACTGTGCTGATGTTTGACGTCTACTAAAGCTTGAAGCAGAGTG ATTAAGATGTAGTACTGATTTTTAAAAGTATATAACATTGCAAATTTGAT AAAATAATATTATTACAAAAATTCAAATACATCTTTGCAAGTATAGTAAC ATTCTTTTAAACAGATGGACTATAACAATTTTTCTTATAAGTATAAAATT TTTTCTTATAACTCATAAATGAGTTTTTCTTTTAATTCTTATAAATATAT AAGTATAGAATAATTCTAGAGTTCAGCTAATAGTAAAGGTGATACATGAG GCTTTTAAAATGTATAATTATCTGTAAACTTAAAAACTGTATAGGTTTAT CAAAGATAAAAGAATTATGAAAAGTTAATATTTCCTTTTATACCAGATTA TTTTCCTTATTTGAATGTTTAAAATTAGGTTTAAATGGAATTATAAGGAC GTTTGTTATTTTAACCAATTGTTAAATTGTTAAAATGGGTCTAAAGTCCA TATACTGTATTATGAAACACAGTATTAAACAGCATCAAGTCTTTTCATTT TGTCCTAGGAAAGTATGATCATAGTCTAGAACTGAAATCCCTTTGCTGTT CTCCACAGACACACCTGCAGGATCCATTTCTAGAGCATTTCTTTGGGCAC TTGGGATTGTTGGGCAGTTTTAGTCAGTCTGTTGTTGGCCCATCAGTCAG ATGTTATATACTGTTCCAGGCAACTATAAAGTTAAAATACTTGCCAGTTG TTTTCAACACATGCCTACTATGAGGAGTCTATTTGCATTGGGCAATTTTA GACAGCCTTATAAGTGATGGCTTTCAGGAAACACGTGTGCTCAGGCACGT CCAACTCTTGGCTAGCCCATGAACTGTATAGTCCACCAGGCTCCTCTGTC CATGGGATTCTCCAGGCAAGAATACTGGAGTGCATTGCCATTTCCTTTGC CATCAGGAAACATCAGTAAAGTCAAATAATGATAATTATTTGGTAATGAG GCTTGAAAGAGTTTTAGCTTCATTCTGCTCATTCCTATGGTTACCATACT GCACCAGGAATGTGTAGGCTGCCACCCTTATGGCAAAAAGTGAAGAGGAA CTAAAAAGCCTCTTGATGAACATGAAAGAGGAGAGTGAAGAAGTTGGCTT AAAACTCAACATTCAGAAAACGAGGATCATGGCATCTGGTCCCATCACTT CATGGGAAATAGATGGGGAAACAGTGGAAACAGTGTCAGACTTTATTTTT TCGGGCTCCAAAACCACTGCAGATGGTGACTGCAGCCATGAAATTAAAAG ACGCTTACTCCTTGGAAGGAAAGTTATGACCAACCTAGATAGCATATTCA AAAGCAGAGACATTACTTTGCCAACAAAGGTCTGTCTAGTCAAGGCTATG GTTTTTCCTGTGGTCATGTATGGATGTGAGAGTTGGACTGTGAAGAAAGC TGAGCACTGAATAATTGATGAGTTTGAACTGTGATGTTGGAGAAGACACT TGAGAGTCCCTTGGACTCCAAGGAGATCCAACTAGTCCATTCTGAAGGAG ATCAGTCCTGGGTATTCTTTGGAAAGAATGATGCTAAAGCTGAAACTCCA GTACTTTGGCACCTCATGCGAAAAGTTGACTCATTGGAAAAGACTCTGAT GCTGGGAGGGATTGGGGGCAGGAGGAGAAGGGGACGACAGAGGATGAGAT GGCTGGATGGCATCACCGACTCGATGGGCGTGAGTTTGAGTGAACTCCCG GGAGTTGGTGATGGACAGGGAGGCCTGGGCATGCTGCGATTTAAGGGGTC ACAAAAAGTCGGACATGACTGAACGACTGAAATGAACTGAACTGAACTGA TGGTGCTTGAGAGGGGGCAATGGGAAAATTAAAAAAAAAAGCTTAAAATT TATGAAAATCATTGTTTTGTTTGTTTTNTAAACTGAGATTCAATTATCTA TTGAATAAAATTCTCCAGTTCTCTAAATTTTATTATGGTCATTCTGCCAG TATTTTCATTGTTTTTATAGAGGAAAAAATTTTCAGAGATCTTTACATTG GCAATTTTTTTTAATATCATCCTCATTTTTTTTGTTATGTTTTATGATTT CCTAAAGTAATTCACCTAGCCCTTTATCACTGAAGCAGACTTAAATTGAT ATGGCAACATTTATTTACACACTGCTAGCAACTATATGGGAGTACTGTTT GAGAGTATCCTTTGACACAGTTTTAGCAAATATTATGTGGCTATGTTGAC TTGTGAATTTAATGAACAGGAATGAGCCAAAACTTGATTCAATAGAAATG GAATTTAATAAATAGAAATTATCATCTTGAAGGAGATTGTATGCAAGACT GCTATTTCACCTCTGTTATCTGAACTGAGCCATATTTCTGTCACAGATGA ACCTACTTTTTCTTTTCCAAAGTTTTAATATTCTAACCTTTGCCTCATGC CTTGGAGCTTGTCACAATGATCCATTCCTGCAGCCTGAATTTTTTTGAAT AGTATCTCACTGTTAAAATACTCAAGTTTTTGAGTTCCTTTAAGTGCATT GGTTGCTATGCAGGAGCAATAGGATTTATATTTATTCTGCTTGTATTCAT TACTATTAATCACTTAGAACTTGGAAAATGGAGAAAAGGCAAGATTGCCT ATCAGTCATTGAAGAAAGTGAGACCGAATATTCTACCTTATCTTTTCTGA GGATCAAGGTTGTTGGAATTCACTGCCAAAATTATTGAATTTAGCCCTCA AAAACTTGATTCATGGTTTTTATTGCTTTCATATTTTATATACTTTTTTG TCATCAATCTTAAGTTTATGTTGGAGTTTTACTCCTATACTTACCCAGCA ACTAGGAAGAAAAACCCCTTTAATGTAAACATTTGAGATTATAAATGATA TCATGTCATCTTATTTTGCAATGTCATTAATCCTTATTTCATAATTTTAA TAGTTAACAACTTCATCACAGGGTTATTTTAAATATGTTTTAAAGATATG CTATGCAGTTGCTTTTATGGATGCAAGCATAAAATGGGAATTTATGAATC AGATGAATCAGTTCAGTTCAGTTGGTAAGTTGTGTCCAACTCTTTGCAAC CCCATGCACTGCAGTATGCTTGGCTTCTCTGTCCATCACCAACTCCCAGA GCTTGCTCAAATTCGTGTCCATCGAGTTGGTGATCATGAATACACTGAAA CAAATATGGTAGAGATAAATAGATGACGTGTGATGATGACAATCATGTGT GTATATGTGATATGATACTTACTACTAGTCTCCCTCAAGGACTAAGAATG GTATGTGGATAGGACATTGAGAACCTTTAAAAAAAAAAAATCAGCTTCGT AAGTCCCTTCTTGATGGTGAAAGCCAGTGGCAAGAAAGGGTACCAGATGA GGAAATGGGCTTGTGGAAAAACTTTTGCTGCCAGGGATCTGCTTTTTTCT TTTTTAATCATAAACTTGATAACTAAAGCCCCAGGGAAAGCAAGAGAACT TTCTATACTTTGATATTCTCCAAGGAATATCTCCAGCTATGAATTAAAGA AATTCTATGCTGATAGGGAGCAATGTAAAATTGAGCATGCAAAAAAGTGT ATGTACGCATAACTGATTTACTTTGCCTTTGGACACCTGAAGCTAACACA ATATTGTGAATCAACTATATTCCAATAAAAATGTTTTAAAAATTGTGTGT GTATTAAAAAAAAATACTTGTTATTGTCACTAAATTAGAATTAAAAGTTA AAAAGGTATTGCTATATTGGGTGTATTTTGAACACTTTTTTACCCCATGA AAAGAAAGCTTGTTGTTAGAACAAATGCCAAAGGATCTTAAGTTGTTTCT GAATTTAAACTTTACTTTTTATGATAACCTGAAGATTATCATTTAATTTT GGACACAATACAGAATAATTCAGTGTCATAAAATGTACTAAATGACAGTT CTTATTTATAACACATCTAACTTAAATATTTATATAATTTATTATTTTAT TGAAAATGCTGTTCTATTACATAATGGCTAAAATGTATCCATCTGATTTT TAAGACCAAGCTTTGAAAACTAAATATGGTTAAGTAATTTCCTTGACAAA TGAAAATAACTTTTTCTGTATGTACCACAAATGCTTTTTAGTAGCTGAAT ATTTATAAACAATAATTATGGGCCCATTGAATAGTGTTACCATTTGTACT GCAAACAATTTTATTTACACCTCAAACAATATATCTATATGACTCATTAT GCTCATTTGATTTTTCTCTTGCTTAACATTTGCTTTCCCTGCTGAATATG AAGCAAAAGCAAACTAACGACTGTCCCCTTGTGTCACCATGATGCCAACT CTTCATCTAAATTATGTTTATAGAATTATTCCAGGTAGTACATTCTCAGA ACAATTTTCTGTTATTTCAAGGATTTCAGTTATGCCTCTGACTATATCTA TAAGCAATCATTAACATTCTTTTTTCCCACTTAATTAGGGTAAATTTTGG AAAAGCTGTAGGGAATAAGAGCTTTCGTAGATTTCATAATTAAGTCTGTC AATGATGTGACAATTAAATTTAATTTCCAAGACAGCTTTAAAATACCACT AAATAACTTGGGTAGATAGACCTTCACAATCATCATCAATGTCATTTTTT CATTCTTCTTGACAAATGGGGGTTTACCAAATAGGGTAGGAGGAAATAGT GTTTCCCAGATAATACACTATAACCTTGTCAAGCATTGCAAAAATGTATG AAAGCCCAGAGAATATTCTGTGCTTACTTTATAAGCTTCTAAATAGTGAC AGTCCACTGGCATAATCTGTACTGCAGTGTACAGGACAGCACTGGGACTC AGTATTGTTTTCCGCGTAATCCTGGGGAAAACTGCGGCTAATTGACCCAA TTCTTTCGGGAGAAAAGCACTACAAAAGAGGATTTCTTTTAAATTCTTCA TTGAATTACTTATTTGGGTGGGCAATCCCAGTATAATGTTTTTTCCTGGA TACCATCTTTGCTGAGTTATAACTTTCTAAGTTATATGAGATAAACTGGG TTGTGGATTACAGTCCATATTAGTATTATATGGAGTACACTCAAAATTAG TTATTTTACTGGGGAATATATCGAAGTAACAATATCAGCCAGACCATTTC AAAACTAATACAATTATGTAAAGTTTAAAAATAAAAAAAATTTTTTTTAA ATTAAATTGAAATATTAAAAAAAAAAACTAAAATAAATAAGTAAATAAAT AAATGGTGCAGTTAAATAGTTCATTTTTTAGACAAAAATATATTGACCTA ATGTGGATATGGACCTAAATTATCGCCTGGTGTATTGAATACGTTTACCA ATGATGGTCTTGTTTCTAACAGCTCACTTCCTCTCATTGGTCTCTGACTT GGATTCTACTTCCTCAAACATAAGCAGCAGAGTTTTTCTTCCAACGAATA ACCAGCATGCTTGTCAGGTATTTGAAAGCACATGGCATTTGAATTACTTT CCACATTTGGGAACTTCATTATTATAATTGTGTGGACATTTATTATTTTT CACAGATTACGTTTTATTGCTTCTCCAGCCAAATGAATGGCAAATTAATG GTTGGCTTTCAAACTACCTGTGGTGGCCCTATACAGCATTTATGGCAAAA CACTCCTGGGCTCCAGAATCGTTGGGAGAGGAATGTCATCAAAATTCAGA GTCCCCAGAGGTTTCAGGTATGTGTGTTGTGTTTTCTAACTGTCTTTGAA GGAAAAATGATAAAGGACAGATGTTTAACACCAGGTGATTAATCATCCCA GTTGTCTGAGGACTGAGGAATTTGCCAGAACTGTCACGTGTTGAAACCAA ATAATTCCAGGAAGTTGGGGCAGCCAATCATCCTAAAAGACAGTTTTAAG AAGTTTAAAATGTGTGTATCAAAACTAAATTTGTTATATACTGACAAGAT GGCATCCCACTCCAGTACTCTTGCCTGGAAAATCCTATGGATGAAGGAGC CTGGTAGGCTGCAGTTCATGGGGTCGTGAAGAGTTGGACATGACTGAGTG ACTTCACTTTCACTTTTCACTTTCATGCATTGGAGAAGGAAATGGCAACC CACTCCAGTGTTATTGCCTGGAGAATCCCAGGGGCAGGGGAGCCTGGTGG GCTGCCGTCTATGGGGTCACACAGAGTTGGACACGACTGAAGCAACTTAG CAGCAGCAGCAGCATATTGATATAAGTAATATGACCTTCTAATACTCTTC CTAATTTCTTGAATCCCCTCCACTTTCCTTTTTCTCTCATTATTCCAATC TTCTTTCATTTCATTTTGCATTCTTAAGAATTTGAGTCACTTCTAGTGAG GTGGCTGAATCTAGAGTGAGGTAAGTCAGAAAGAGAAAAACAAATATAGT ATATTAATGCGTATATATGGAGTCGAGAACAATGGTACTGATAAACCTAT TTGTAAGGAGCAGTGGAAATGCAGACACAGAGAACAGACCTGTGGGCACC GTGGGGTTAGGAGAGGGCAAAATGCATTTAGAGAGTAGCGTTGAAATATA CGTAACCATTTGTAAAGTAGATAGCTTTGGGGAAGTTGCAGTGTAACACA GGGAGCTCAACCTGGTGCTCTGTGACAATCTAGAGGGGTGGGAGGAGGGG TTCAAGAGGGAAGGGACACATGTATACTTCTGGCCAATTCACAGTGCTAT GTGGCAGAAACCAACACAACATTGTAAAGCAATTATCCTCCAATTTAAAA AAAAATTGCTTCTGTTTCACAATTTTCTCAAGTTCTTGAGAGAACAGGAT TGTCTTGGGTAATGAGAACATAGACTGTTTTCAATACTAATACCAAATGC TGCTGAAGTGGAATCATTGTCACATTCATTTCATGGTTAAACTCAAATTA TTCAATACAGCCTTCATCTTCCAAAATAATTTTGAGAATTAAAGCCAATG TAAGCCTATAAAAGACATTTATTTATGCAGCCTAATAAAACTTATGTATG ATGGAAATTATAATCTAATACGTATTATAGAAGTTCTTAGAAAAATAGTG CATACTTTAACATTTTGGGCAGCCAAGCAAAATTTTCCTGTTAAAAAAGG GATCTTAAAACATTTTATTCTGAACAAATAGGCTTTTTAAACCTGGTTTG TGACTCAATTTAGCCCAGGTAGGTTTCCTTTATCATCTATTATTAGAATA ATATAATAATTTTATAATTTTGATATAGAATAGAAAATCATCCTATTCTA TAGAATCATTCTATAGAAAATCATCTGATATGTGATAGATGTAGCACTTG CCTTAATAAAGAGAGTAAATTGTATTGAATTTTGAGTGGCTAAGAGGGAA TATTAGAGAATGAACAAGACCTCTATTACTAAAATTGAATGATAAGATAT AAGAATGGCACATATTCTTAATTGATCTGTCATAAAATCACTGAAGTTCA GAATTTTCAGCCTTTTGTAAAATCAAATGGGAATCTAAAGAAGATGAAAG AAAATAATTTAGTAGATAGTTAGGTGACTCCTGGATGATGGCTTGAGGAG AACTGTACAGCTGGAAGCATAATTCTGTCATTTGAGGCTTTGTATCCTCT TGAAATCCAGTATTACTGGTGTGTGTGTGTCTATGTGTGTGTGTGTGAGG TTGGGGTGGTATTTTAAGCCATCAGCATGTAAGTCTTCCTATAAAGGACT CCTCAGGCACAGGGATAAGACATCTTGAGTTCCTGCCTTGGTGGGGAGTG CTCTGCAGAGTGAGAACCCCAGACAACAAGAATGCATCCCATTTGTTGTG GATGTTCAGGTGTCATTGACCAAAGGAGACATTTCTAGTTTATTTATTAT ATTACTACTTTATTTTCTTACTTCCCTGTATCTGTCTCTCTTCTGTAACA ATAGCAACAAAAGAGAGCCAAGAGTACCTCTGAGGGGACACTGACTAGAT GCCGAAGGATGAGCTCGCTGAAGTCCCTCTGCACGCTTGTCTAAACCTTA AGGACTGCTATGGGACTCTTGTCTGTGTGTAAACTTTATCGGTATTTATA CACCTTTTCCGACTTTGAAACAGAGTGGGTGATTAAAAAAAAAAGTCTTA AGCTATCTTTGTCAAGCATTGTGCCTTCTTATTTTAGTACAGAGTCTGCC TGTCAATGCAGGAGATGTGGGTTTGAGCCCTGGGTCCAGGGAGATCCCCT GGAGAAGGAAATGACAACCTACTCCAGTGTTCTTGCCTGGAAAATCCCAT GGACAGAGGAACCTGGTGGGCTATAGGCCACAGGTCACAAAAGAGTCAGA CACAACTTAGCAACTAAAACTACAACCAAAAGAAATACTTTGGTCAAGGT CTTTATTAGTAGCACGACAAGAGATTTGATGTTGGATATAAGTAGCGGGA ACCTGCTACTTGTAAGTTAAGCGTTTTAGGATAAATTCTTTGCTTTTCTC GCTGTCCATTCCCAAATAGCATATTGTGGGGGTTGATGATTAAATATATG TAGTAGATAACTATAAAACTTTAAATTCCCAAATAGATTATTTCCAGGGC AATTCAGCTGTAGCAGAGGAAGTGAGATTATTCACCTGAGTACTTTAAAA TGCAGCAGTGTCTTCCACCAAAACAGATGCCCATGGAGCATATTAATTTG ATTCTCAAAATCCTTCATTGCTGATATAAAAACAGTGCTTCTACCGTAAA GGCATTGCTAAAAATTAGGAAACTGTATGACTCTCATGGGATCCTCTGGC TACACCGATCTTTAAGATCTGCAGGTATGTTTTAGCTCTATCCTGTCAGC AAGTGAACAGATACTCATTTGCTTTTGTTGAGCTGGGTCACAGAAATGTG CTGTACTTGTAGTACTGCCGGCCTCTATGTAGTAGCCCTTTCCTGAAAAG CTTTAGAAAGAGGCTTAGTTGGGGGCATTTTGTAATCAGCGTCTCCAGAC AGTATCTGCTGCCTCATCAATTTATAAGTCTCCTAGAATTATTCTAGGTT TATTTTTTTGTTTGTTTTTCTTGGCAGTTTCCCATGCATGCTGCCTTGAT GGTTGTAAAGTCATTCATGCTTGCTTTAGAAATACTTACATAGATTTTAG TCCCAGCTGGACGCTGGCTTAGCATGGGTTTCTGAGAAAGCCTCTGGATC TGGCTCTTGTGTGGAGACTGTCACCTTCACCTGTAAAGGACTAACTAGAT CCATCCCTTGTTAACCTGAAGTGTATGTTAATTTCTGAGAGACTGCTGCT GTATAAACTAGGAATGGTGTTATGCATTTAGTCCACAGAAATGGCAGTGT TTCAAAACATTTTTGAAGGTGTTTAAAGAATAACATCTAGTATTGACTGA GTGCTTACTGTGTGTAAAGAATTGCATTTAGTCCTTCGTGTACACTATCT TATTGGCCCTTCATGGCAGTCCTCTCAACTATCATTTACCCCATTGTTCA CATGAGGATTGTAAGCTTTATTTTTTAAAGATGTTTTGATGTGGACCATG TTTAAATTCTTTACTGAATTTATTACAATACTGCATCTGTTTCATGTTTT GGTTTTTTGGTCCTGAGGCAAATGGGATCTTAGTTCCCCAACCAGGGATT AAACCCAGGCCCCCTGCATTGGAAGGCGAAGTCTTAGCCACTGGAGCACC AGGGAAGTCCAGAGGACTGTAAGCTATAGAGAATGAAATAATTTACCAAA TCCCATACAAGATTAGACCATAGGGTAGTTTGATTTCAGATCTCAGTCAG TCACTGAGCCACGATAATTTTTTATCTAATAAAGCCGCGTAAGAATTTAT AAAATATAGAAAAAAAAATCCAACCTCTAGATTTGGTCAGATCTGATGTG ACTTGTTAAAGAATCCTTTGTCTACTGTGTTAGATGAAACATTATTATGC ATTGCATGGTGCTAATGAACTGCGATCACATTTCTCAAAATTGCAGACAA AAGCAATTAATTTTACTCTTGTCTTAAAATATTCACAGAAGCAAAGAATA AACCACGCTAAACGTATAGTAGAAATTTAGCCTAAAATTCAGATGAAATC TCCCCTCATCCCTGTTTTTTTCTGGTTCTTGAAGGGATTTCCCCCATTGG TTTTATGGGTAGGAAGGAATAAATACTATGTTACTAAGTATATCATTGAC TGTTATTTCCAAGTTGAATGTCTAGATTCTTGAAATCAGTGCCTGAATTT TAAGATGATACTGAAGCATTTTTAATATGCTATTATATACTTGTCAGTTC TCTGATATTCCACTTAGAAATGTCAGAGACTTCTCATCACTCTCCCATTC AGAAACAATAGGCTTTATAAGTACAAACAAAAGATGTGGTTAATAATGAT GAATATAAATTATTAACTTACTGCTACTCTCAAACTTTTCAAAATCATAA TTGAGACATTTATCTTTAAATTCAAGAATACTTACTGTGTGAACACATGA CGATGAAAAGACTACTGTCATCATCTTGTGTTTTATATATTTTCTTGAAA AAGACCATTAAATGCATACTACTAATTAGGAAAATTCTCATACAGAAGAT ATAAACGCAAGGGTTTCTGTTCATGTCGTTACTAGTATAAGCCAAGTGAG TTTATATTCATTGTTCACCTGCCATAAAAGTTTCATTGAAGATTTAAATT GAGTATTTCCAGCACAAAGCCTCCCTTCCAAGCCATCTTCTCTTAAAATG TTTGAGGTGAAAGGAATTTGTCTCATGTTTTCCATTGCATCAGTGCAGCC CGTACCTGGCTTACGTGATGGTGTCAAGCTTCTAACTTCATTATCTGCGC TGTGATCTGCTTTTGATTTGCTACTTTGCTGTTGTTTTCTTTTCTTTATT TTGGCTGTGCCCCTGAGGCACTCAGGATCTTAGTTGCTTGATCAGGAATC AAATCCTTGTCCCCTGCAGTGGAAGCACAGAGTCCTAACCACTGGACTGC TAGAGAAGTCCCTATCTTTTTTTTTTTTTTTTTAGCTTCACCTAACAGAA AAAAATGAGGTGGGTATTTGGAAAAGGTTATTTGACTAAGTTTTGGAGAA AACAAAGAATGTTTATCACTTCTCTTAGAAATGCAATTACCATATCACAA ACAGCCTCTGACTACAGGGCCTGGTTTTTAAAAAATTATCATGGGTTTCC ATGTTCTTTAAGGGCTTCCCTGGTGGCTCAGACAGTAAAGAGCCAGCCTG CAGTGCGGGAGACCCAGGTTTGATCCCTGGGTTGGGAAGGTCCCTTGGAG AAAGAAATGGTAACCCATTCCAGTATTCTTGCCTGGAAAATCTCATGGAT GGAGGAGCCTGGCAGGCTACAGTCCATGGGGGTCACAAAGAGTTGGACAT GATTGAGCAACTTCACTCACTTTCCACATTCTTTAGATAATTCACTCATC CCCCTTTTCAGGATCCCAACCAAAATCCCTGGAAACTTTTTGTTTAAATA CATTTAACTGGATTATCTCCTTGTACCTGGTGGGTCTTTTGTTTCCTAGC TACGTAGATCCACAAGTAATTTCCCTACAATTAGAGAAGCAATTCTTTTC CCTAAGAAAACCTTTGCTCTTGCAGTGCCAGTGGGCTTAAATGATGGCCG ATTTTCATACTAGCTTCTCTTCAGTTATACCAAGTTAATCTATAATTTAA CTGAATCAAATAAATAAATACACATATTGCAAACTCTGAAGAGAGGCTTG AAGGTAAGAAGGTAATTTAAAAGCTACTGCAGGACTTCCCTGGGTGGTCC AGTGGTTAAAATTCCAAGCTTCCAATGCAGGGGGCCTGTGGTTCAATCCC TGGGAAGGGAACTAGATCCTACATATTGCACCCAGGAATTTGCATGCCGC AACTGAGGCCTGGCAGAGCCAAATAAATAACATAAAAGCTACTTCATTAG ATCAGGTGTGAAGATGTAGGAGAGGAAATAGCAATGGAAAGGAAAGAGGG TTAAATAGATCTTGATCGATTGGACATGACTGGGGGAGAAAGTGATGCCA AAGGTCATTTTGGAATTTTGAGCATTGCAGATGGCAGTCTCCTGGTACCA TTTTCAGAGGATGAGCGTCAGGGCAGAGGTCCAAGTTGAGAGGAAAGAAC ATCTTGAATTAGAAGTGACTTGGTGTCTTATAAGGGAAAATATTCAACAG ATGGTAGAGATGGGGAAGGAGATAAGGGGAGAAAGAGGTTGACATTCCTG ATGTAAACAGTATTCATGAGCCTGGGATGAACTACGCAGTAATCACCCCA project fbnr AD 20040903 16933bp GGGGGCAGCAGGTACGTAGTTCATCAAGGAGAAAAGGAAAAAATAAGCAT CTGAATGCAGAGTTCCAAAGAATAGCAATAAGAGATAAGAAAGCCTTCCT CAGCGATCAATGCAAAGACTTATTAGGAAAACAACAGAATGGGAAAGACT AGAGATCTCTTCAAGAAAATTAGAGATACCAAGGGAACATTTCATGCAAA GATGGGCTCGATAAAGGACAAAAATGGTATGGCCCTAACAGAAGCAGAAG ATATCAAGAAGAGGTGGCAAGAATACACAGAAGAACTGTACAAAAAAGAT CTTCTCGTCCCAGATAATCATGATGGTGTGATCACTGACCTAGAGCCAGA CATCCTGGAATGTGAAGTCAAGGAGGCCTTAGAAAGCATCACTATGAACA AAGCTAGTGGAGGTGATGGAATTCCAGTTGAGCTATTCCAAATCCTGAAA GATGATGCTGTGAAAGTGCTGCACTCAATATGCCAGCAAATTTGGAAAAC TCAGCAGTGGCCACAGGACTGGAAAAGGTCAGTTTTCATTCCGATCCCAA AGAAAGGCAATGCCAAAGAATGCTCAAACTACCGCACAATTGCACTCATC TCACATGCTAGTAAAGTAATGCTCAAAATTCTCCAAGCCAGGCTTCAACA ATATGTGAACCGTGAACTTCCTGATGTTCAAGCTGGTTTTAGAAAAGGCA GAGGAACCAGAGATCAAATTGCCAACATCAGCTGGATCATGGAAAAAGCA

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnr.fa (2013-03-31)
    Open archived version from archive


  • AAAAAACCACTAATTCAAAAAGAAATATGCATCTTTTTGCTCATTGCAGC ATTATTTATAATAGCCAAGATATGGAAGCAACCTAAATATCCACTGATAG ATAGGGAAGATGTGAGATTAGATAGAAAGATAATGGAATATTACTCAGAT ATTTAAAAAAATGAAATTTTGCCAGCTGGGACAATGTAGATGTACGTCGA GGCTATTAAGTGACGTGAAATGCTCCAATCATCTAACATCACTGTGATAC CAAAACCAGACAAAAAAATCACAAAACAGAAAAATATAGGCCAATATCAC TAATGAACATAGATATAATAGTCATCCAGTATAAGCAAATTGAATTCAAC ATCATTAAAAG project fbns AD 20040903 15576bp AAAATGAAGATACTAAGTATTTCCGAGCCCATTAACTTGCCTAAGATCAC TTAGCCAGTAAGCGATGGAGTTAGAATTGATATCCAATAGTCCTTCAGTG CCAAATGAAAATTCATGACCAATCTTTTTCTCTTTCCCTCCCTCCCCTCC TACCCACTCCTCTTTGTCTTTCTCTTGGCTTCATTGTTTTATCATCTGCA GTGAATTGGAAAATATACTTTCTGATCTTCTGATTATAAAGTGGTCTGCT GAGCAGATGATGCAGCCTTTCTTTTAAGAAAAATATCGAAGAGTGTTTTG TAAGTGAATGTATCTATTGTTAAATCAAAAGGGTGATTACTTAGAAGACA AGAAATTAAGTAGTTTCTGAGAAACTGAAAGATCTGATGATATTAAAGAG GGAAAGTATGTATGGGCCAGCAGGAAAGTACCAACACAAAAAAGCAGGAG TGAAAATCAGGAAGTTTCATGAGTGGACAAGTAGAAACCAGGAACATGGG AATGTAAAAGGGTACCAACAGGAACTCTGGTCAAGTAATGCGTGAGGAAA TACGTGTGGCATTAGACAGGCATCTGAAACTGGGTGACATGTTTCCATGT AGGAGCAGAGTTTAAGAAGAAAGAGTGTCTCCATTTGATTAATGATGTCA GAGAAGAACAGGAAGTGGTGGAGGCCAGAATAATATTGGCTGGTGTACTC TATCTGGCGGGATTATTTGTTGTTGTTTAGTGACTAACTTATGTCTGACA CCTTTGCAACCTCACGAACTGTAGCCTGCCAGGCTCCACTGTCCATGGGA TTTTCCGGGCAAGAATATTGGAATGGGTAGCCATTCCTTTCTCCAGGGGG TCTTCCTGACCCAGGGATTAAACCTGAATTTCCTGCATTGCAGGTGGATT CTCTACCACTGAGCCACCAAGCTTACTTAAATCCAATTTCTCCATAAGAG TCCAGAGCACAACCCTGGGAGCTGCTGCTACTTCTCCCCAAAGTTATGTA GTTAGGATCCTCAACCGCAAAGTTTATAATTAAAAGAGAAAAAAAAAGTA TACGTAATACACAGACAGAAAAGCTTATGTTAATAAAATGAAAATTACAC TGATTACACTGTAAGCAAAAAAGAAAAGACTCAACTAAAGAACAGGGGAA CACATTTTAATGCTTACTCCCAAAGTAAGTATTTCTTTGAGAAAAAACAA CTCCAATTGAAATCTCAAGGGAATTTTTCAAACTAAAAATCCAGTTCTGA AGTGAAATTAAAAGAAAAAAACAAACAATAACATAAAATAGAAAATGTAA AGATTAGAGACTGGCACCATCACATATTAAAGCATATTTTATACATATAT ATAATCATTAAGACAGTATAGCACTACTGTAAAAACAGGCAGATCAAGGA ATAGAATAGGAAACCTAGAAATGAAGCCAGTAAATACAGAAATTTAAAAT AGGTTTATAAGCCCTTATCTCCAATTCCAAAATCTCTAAAAATCTCTGAC AACCAAGCTTTTTTTTTTCCCCAAAAAACTGATTTGGAGGAAAAACTAGA AGTTAATTGATAAGAGGCTATTTGTAGCCTTTTAAAATCCCATGTAATAG GAGCACTCAGAAGTTTCATTAGAGAAATAGCCATGTGTTGGATTACAGGG TACAGCAGAGGTGTTATATATAATATGTGTTATATTCCATATACATTTTT TCTGAAGGATTGGGATAACATCAGAAATGGGTTAAAATCTAGATGCATGA GAGTAAAATTTTTACTAACATGGACTTTCCTTTATGTCTCAAACAAAAAT TTATCTGAATCTTAGTCTTTTTACACATAGAAACCTTTAAAGGCAATTTA TGTTATTATTCAAGGAAGGGCTCCAAATTCTGTTATGTTTTCAAGGCTTC TTATGGAAGAAAGGTGGTTATTAGTGGTTTCTGGTCTATTTTAACTGGAT AAACATAAGTAGTTTCTACATATACACTGAGTGGATAAGCTTTATGTAAA GGTGGAGCTTCAAGGATAAGCTTAAAGGAAAGAGAGCATGGTTGCTTCAG AGAGATCCTCAAAGAGAAGGGTTAAGATGGCATCCAGAGCAGAGAGAGGC ATTGGCCAAAGATGAAGGAGAAGGGCCTCCCCAGGCTGGAGGGGGCAAGA GAAGACACTCCATGTGTGGGGCTTAGGGAATTAGAGAAAGAACCCACAGA AAGAACAGGAACATGTCCTCTGCCAATTATCAGCTGAGAGGAGTGTGAGC TTAAAGGACTGGGTAACTTAAGGAGAGTAATGAAAAGACTTAACTCATCA CAGTGGGAAAAGAGTGTACACTGAGTGGAGTGGGAGTGTGTTTTTAGAAC TCCAGTACTATCAGAGACCAAAAAAGTCCTAAGAGAGTCTCACACATTGG AGTTCACCTGGTCCCTAGTCCCCCATTATCAAAACCATTTAGAGCCATTT GCATTCTGCAATCCTGTGTCCTCCTCCAGGCATGACAGGACTAGTAGCTT GCCTATCTCTGGACTGAGAACCACTTTGGCTCTGGCTACTGCTGCCACTC CCAAGGCAGTGAACTGATTCTGGCTCCCGAGGGTTCTTACTTGACACATA CCTCTCCAGGGCTCAGCTGCCACAAGATTGCCAACAAGTTGATGAGGAAG AGATATAAACAAAATTGGCAGGCAATTTTCTCAGGACTTAGGGAGAAAAA AGGAGACTAAAATGGTAAGAAAGAGTGGCAGATTCTCTTAGCTGAGACCA AAAGACTCAGAATCAACTGAATGCCAGAGGACACATTAGCATTTATCCAG AAGAGACCTTGAGATGAGCTGCTTTGAGTTTGAACATGATTCCAAACCTA GCATCGACTGTGAAATAAGCCTGCTTTGTGCAGATCCAGTTGGAGCCCTC TGAAGAACGCCCCCACTGCCGGAATATTTTTTGACATACTGCAGCCTTGT CTTGCAGGTGGTTGACAGCCTGGCTCAAACTGCTGAGTACATTTTGGACC CAGGAAAGCCCTGCTCAGTGAAGAGGTAAGTAAGCCAGAGAAACACCTAA ATGGTAGGACCTTAACCAACAGCAGTTCTAAATTTCTTATTAGAACAGGC AGCTGAACCTAGGACGGGGAAGATTATTGCTCAAAGTTGCAAAACTAAGT AGTAACTGTCCTACATGTTTGACCTCTCTAAACCCACTTGCCCATTTGAG ATTTCCCTCTTCTGTTTCTTTTTGTACCAGATGTCTGGAACTAAATACCA AAAAAAAAAAAAAAAAAAAACTTTTGAGAAGGAGGATGGGCGGAGTAAAA TAAATATGAAGACCAAATAGGAAATTTTTCTCTATACCTCTTTGCAAAGT TCTTCTGTGTCATTTGTTTTGAAAGTTATTTCACTTGCTAAATATTTTTT TCATAGGAAAAAAAGCCCACTGAAAAAGCTACATCTGTATAAAACAGATA AATGAAGAGCTGTGGTGATAATAGTAGTTGGGGGTGGAAGTTGGGAGTAG TTAGGGTTGGAAGTGGGGTGAGATGCACAAACTCAACTAGGCTTTCGGTG CCTGTGGTGCTTCAGCACTGGGACAGCATGTTTAGGCTCCAATGAGCCCA AAAATGACTCTGGAAAAATTTCACTAGAGTCTGGGATCCTGGGGATTTTG AAAGTTCATTGAGGCCTCCAGATGAGATTAAAGTGTAAGCATAGTAGCTG CTGGAAGTGTGTAAAAGAATGAGAGGATTTTTTTAAAGTAAATTTGCTGC TGTTTATAAGAAGGAAGAAAAGAAAAAAAATTTTGCATGAATAAATCTTA ACCCTTCATGTCTATCATCATTTGCTTGATGCATCAGTGCCAGGACTTCT TCAGATGCTTCAGGAAGAGAAACAGGGGAGGGAAAACCAGAGGGGCCATC TCTACTATTCCACTCGCCCCACCTCCGTAGAGGCTGCTTTTTTACAGCCT GACTTGATTTTCACATTCACTCTTTTTCCTTAGATTTCTCTTGGAATTTT CCCTGGCCCAGAAGCTTCCATCTTTGTTACAAGAGGTCAGATCCCTGATG CCATATGTCTGGGAGCAGCAGGACATCCTGGTTAAGGAGAAGGTTCATAT CATTGGGTCAAACTTCCAAGGACACTTCACATTCCTGCCTGGGTTCCCAA GTTCCCTCTGGAGAAAGCATAATCTCCAAATTAGGGAAGATTTTTCTCAC AAATAAAGTTTTGCAGCATTGCAAAGTAGGAAAAACATGGGATTTGAAAT TGGAGGACCCTGGATGTGAGTCCCAACTCCATGACTTTGTAAAGTCTATG GCATATGTCACAACATTTCTGTCCCACAGAAATGAAGTCAGTAATACCGA TGTTACAAAGTTTTATAAGGATTAAATAAGATCAAGATTTTGTTATAGTG GTTGGCATATATTATGCAATAAATGAATAGTAGTCATTATCATGTGAGTA AATATGTGGTACATGGTGGTGGAAAGATGTGTGAAATGAGGTTTGTGGGA GAAGGGAAAGAAGAAGGGAAGTAAGATTTTCACTGACAGGTTTCAATATA AAATGCAGGTCATCAGTCAGTGTACCCAAGTAGGAGAGAGAGAATGTCTG GAGAGAATAACTAATGACAAAGTCTAGAAATCTGATTGAAGAGAGGGAGC CAGTAAACACTTTGCATATTTAAACAATGCATTTTGTGAAAACACAATTT CACAGCAAAAGGAAATATTAATTAGGAAAAATATGCATAATCTTGACATA CAACAGATCACAAATTTTTGTTTACCATGAACCATTTCATTCTTCTGCAT TTGCAGAGGGCTTTTAAATGCTTATTAAGCATTTAATAGATTGTAAAGAT TTTGACCTCATTTTTATTCCCATTTTTCATTGGATAAGGTCATGTATTTA ATAGGTTTCCCAGTCAGTGATCAGCCAAGGACCCTTTGACTCTGAGTTCA ATGCTTATTTCACTATCACAGCAAATGCTGTTGAACTTTAGGCCATTTGG AGAGTCAGAGGACTAAGGAAAATAGGGCCACTCGTATCAACCCCAAACCA TACTAGCTCAACCTGAAACTCTTTAAATCCCCCAGTATTTATTGTCTATC TATGAAGCACTAGAAGGAGAGTTGGTTGTGAAGTCAGAAGCCCTGGCCTA CTTCTGGCCCTAAGATATCTAGTTATTGTGGAAGTCTTGTCACTGCTCTG TCCCACATTGTCCTCAGTCTGAAAATATGAGGTCAGATTGCATGTCAGGG TTGACATATCAAATGAGACGTATTAGGAATTTAAGCTCCATTATTTTGAA AAGCAGCCTCCCAATAAAGGATTTCTCTGGGTGTCTGTCTACTTGTTGCA ACTTCTAGGGTTCAGCAGGTCTTGGATGATATCAGATGATGAGGAAAGGC TGGGGGAGAGCATGAGAGGATACAGATTGTGAGGGCCTGTGACCTAAGCA GTCCAGAGAGATGGTAGAATGGAGATTTTAGCTGAGAAAGCATTCATTCT ATTATTCAACAAATGTTTATTTAGAGTCATCTAGCTGGGTTTACTACCCG ACTCCAGTACTCTTGCCTGGAAAATCCCATGGATGTAGGAGCCTGGTAGG CTGCAGTCCATGGGGATGCGAAGAGTCGGACATGACTGAGCGACTTCACT TTCATGCATTGGAGAAGGAAATGGCAACCCACTCCAGTGTTCTCGCCTGG AGAATCCCAGGGACGGCAGAGTCTGGTGGGCTGCTGTCTATCGGGTCACA CAGAGTCAGACACGACTGAAGCGACTTAGCAGCAGCAGCTGGGTTTACTA GGTCTACTGCATTTCTAGGACTGTGACACTTTTCTGATCATCTTCTCTTA CTCAAAAATTATGGACTTAATTTGAATTATTGACAATTAGGAATGCATCA TGGGATGGAATGGCAGAAACCAACAAAGATCCTTTCCTGTGTAAAATATA AATTCTAACAGGAACAGATAATCTTTAACATACTAAATCCATTATCTATA TGTTAGAGATGTTAAGAACTATGGGACATTCATCTTCATAGGAAGTACTT AGAGTCAGGAAAAGGAAAGTTGCAGTATTTAGTAGAGTAATAGGATAGTC AGGTATTTATTTACCCTCAAATTCACTTTCTGGCTTAAGCTAAAAAGTGG ATCTTTTATAAATTAAAAATCCTTTTCCCAGAGAATGACTCAGATCATCA CCCCACTAAATAAGTAAATATGTTTTTATTTTTTAGGGATGGAATATCTA AGAAACCATGAAAAATCTTAGCACTATTGATGAATTTGTGCTGCTGGGGT TGTCTACTGACCCGGATATCCAGACCATGCTCTTTGTTCTCTTCTTGGGG ATTTACCTCCTGACCCTGATGGGGAACCTGATGATGATCCTGGTGATCAG GGCTGATCCTCACCTGCACACGCCCATGTACTTCTTCCTTGGTCATTTGT CTTTCCTAGACATATGCCACTCTTCAATCACCATACCCAAGATGCTGCAG AATTTCCTGTCTCAGAGGAAAACCATTTCAGTGTGGGGATGCATTACCCA GAGTTTCTTTTTCATTTTCTCTGGAGGCACAGAGAGCTGCCTGCTCTCTG CTATGGCCTACGACCGCTATGCTGCCATCTGTCACCCTCTGCTCTACACT ATGATCATGAATGGACCTCTGTGCACTGCAATGGTCAGTGCAGCATGGGT GATGGGATTTCTGAACTCACTAGTGAATAATCTTTGTACCCAGAACTTAC AGTTCTGTGGTCCCAATATCATCTCCCACTTCAGTTGTGAACTGCCTTCA CTCTTCCCTCTGTCCTGCAGTGACACCATGCCTAACACCATCCTGCTGGC TGGGTCCACTGCATTTCTAGGACTTGTGACACTTCCTCCAATCCTCTTCT CTTACTCAAAAATTATTCTTGCCATTTTAAGTATCTCCTCCTCTAAAGGC CAAGGCAAAGCCTTCTCCACCTGCTCCTCCCACCTCACCGTGGTGCTCTC GTTCTATGGGACAGCTCTATTCAGGTATATCAGCCCCTCTTCAGGATCAG TCCTGGAGCAAGTTGTCTCCATACAGTATGGTGTGATCACATCCTTGATA AACCCCCTCATTTACAGCTTCAAGAACCAGGAGGTGAAGGCAGCTCTGCA GAGGATACTGAGGCAGCAAATATGTGTCTCAGGGTAAGAAATGGCAAGGA GACCTTTCTTCTACAAGAGAAGCAATCTGCAAAGGAAGAGAACTTTGTAA ACTTAGAGCTCCTGTGGAACTTGATTTTTAATGTAGCTAATTATGTTTGT TTCTCATTCAAATTGAAAAGACTTCCAAAAGCTGAGAGAAATATAGTCAG AGAAGTATTTGGCCCATCCTGCATCTGACAGAAAAGGTTCAGAGACATCA GCTCCTTCCATAGCCTTTGGAAACTAATACAGAACAGTGACTTCACTACA GTTTAGGAGGCAGAACAAGGACAAAGCTCTCTGAGCCTAGGACTTTACCT ATGGAGTTACCAAATGAACCCATTAGTAGAAGGGCAAAGAACAAGTAACC TTGACAGATTTAACATTCCAGAATGGACAGTTCATTACCTTTTGTTCACT GGAGCTGGTGGCACCATAGGCATTAGATGGCAATGTGTGCCTGCAAATCA TCAGAGAATAGTGAAAGCAAAGAATGAACATTACATCTATGAGCAAATGA ATGGATAAAGAAAATGTGGTACAGTCTTACAGTGGAGTGGTACTCAGTTT ATAAAAGAAGGAAAGTCTGCAATGTGTGATGACATAGATGAATGTTGGAG ATATTGTGTTACGTGAGAAAAGCCAATCACAGAAGAGAAAAACTGCTTAA TTCTACTTATATGAGGTATCTAAAGAGGTCCACTTCATAGAAGCAGAAAG TAGAATGGTGGTTTCCAGGGCCTGGGGAAAGGGGATTGGGAAACTCTGTC CAATGGACATACAGTATCAGTCATGCAAGATAAAAAAGAGATCCATTACA CTGCAATGTGCATATACTTAACAGTAGTATACATAAAAACTTAAGAGGGA AAAATCTATGTTGTGTTTTTTATCACAATAAAAAATAAATAAGAGTGAAC ATATCATTACACTAAATATCAGTATTGCATTTTGCAACCTCTTGTCTGAA GGCACACTTCATTTTAAAACATATCATCATATTTGAGATATATATATATA TATATATACACACACACACACACACACATCTATGGATACATACACATACA CATATGGAAGCCAGACAAAACCATTAGGAGTAGCATAATGTAGTTTAAAA CATTAAGAGAGCATTATTTTTATTGGACATAAATCAATGAAGTTAGAACA CTCCCTAACACCACACACAAAAATAGAATCAAAATGGCTTAAAGACTTAA GTTATGACACCATGTGTGTGTGATTGCTGATCAGTCATGTCCAATTTTTT GAGACCCCATGGACTGTAGCCTGCCAGGCTCCTATACCATGGAATTATCT AGGCAAGAGCACTGAAGTGGGTAGCCATTATCTTCTCCAGGGATCTTCCC GACCCAGAGATCAAACTCAGGTCTCCTGCATTGCAGGCAGATTCTTTCCC ATCTGAGCCACCTGGGACACCATGAAAGTTCCAAATGAGATCTCAGGCAA AACATTCTCTGACATACATCATACCATATTTTCTCAGGTCAGTCTCCCAA GACAAAAGAATTAAAAGCAAAAGTAAATAAATGGGACCTAGTTAAACTTA CAAGGGCTTCCTTGGTGGCTCAGAGGATAAAGTGTCTGCCTGCAATGCAG GAGACCTGGGTTCAATCCCTGGGTTGGGAAGACCCCCTGGAGAAGGAAAT GGCAACCCACTCCAGTAGTCTTGCCTGGAGAATCCCATGGACAGAGGAGC CTGGCGGGCTACAGTCCACGGAGTTTCAAAGAAGTCAGACACAACTGAGC GACTTCAGCTTTTGCATAGCAAAGGAAATCAGGAACAAACAAAAAGACAA CCTATGGAGTAGGAGAAAATATTTGCTAATGACCAACCAGCAAGGGTTTA ACTTCCAAAATATACTACAAACAACTCATACAACTTAATATAAAAATCCA ACCTAATTAAAAAGTTGCAAGAAGCCCTAAATAGACATTTATCCAAAGGA GACATATAGATGGCCAACAGGCACATGAAAAACTGCTCAACATTGCTAAT GATTAGAGAAATGCAAATATAAACTTCACTGAGTATCACCTCACACCAGT TAATGGCCCTCATCAAGTAAATTCTGGAGAGGGTGTAGAAAAAAGGAATT TTCCTACAGTGTGGAGAGCAATGTAAACTGGTATGGCCACTATGGAGAAC AGTATGGAAGTTCCTTATAAAACTAAAATAAAGTTACCATATGATCCAGC AGTCCCAATACTGGACATATATATATCTGGAAAGGATGAAAATGCTAATT CAAAAAGATACATGCACCTCAGGGCTCATAGCAGCACTGTTTACAATAGC TAAGACATGGAAGCAACCTAATGGTCCATCAGCAGATGAATAGACAAAAG AGATGTAGTATACATAAACAATGGAATATGATTCCACTGTTAAAGAAGAA TGACATAAGGCAATTTGCAGAAACACGGACGCACTTGGAGGGCATGAAAT GTGAACTACATCAGACTGTGAAAGACAAATACTATATGGTATCACTGCAT GTGAAATGTAAAATATATGACCTCTGAACATAACAGAAAAGCAGCAGACT CACAGATATAGAGAACAAAATAGTGTTTACCAATGGAGAGAGAAAAGGGA GAGAGATAACAATATACCAGTAGGGGATTAAGAGGTACACACTCTTAGCT AAACAGTCAGCTACAAAGATATAATGTACAACACAGGGAATATGGAAAAT ACTTTATAAGTGGAATATAACCTTTAACCAATGTGAATCACTATTATACA CATGTAATTTATATATTATACTTTACATTTCAGTAGAACGTTTACTAAAA GAATAAAATTAAAATTGAAAAAAAATATTTCAACAATTCATTGTTAGTAT GTTAGATATCAACATATAGCCCATATTTTATCAAGTTATACCTATCCATG TTTACTTACAAAGTGAAAGTGAACTGGAAGTCACTCAGTTGTGTCTGACT CTTTGCAACCCAATGGACTATATAGTTCGTGGAATTCTCCAGGCCAAAAT ACTGGAGTGGGTAGCTATTCCCTTCTCCAGGGGATTTTCCCAACCCAGGG ATTGAACCCAGGTCTCCCGTATTGCAGGCAGATTCTTTACTGCTGAGCCA CCAGGGAAGCCCTATTTATAAAGGTATACTATCAAAATAATTTGAAAATT GTAAAGTAGATTTTCATCATTTAATGAGATTATTATATGTCTTCTTATTG AACAAACTGTAAATTTTCCTAACATTAAATGATTGTTACATTCATGAGAA AACACATTCATGGATATATCTTTTCATATTCCATTAAATTATTTCTATTG GGGAAGTGTTCACATACATACGTAAAATTAAAGGTGATTGTTATTTAGGT GTTAATATGAAGACTATGTTATCCCAATCATTACATGCTGAAATCTTTTG TAATTTTGTTGACTTTCATTTCATTTCATTTGCTTAAGATTTTAAAAAAT ATGTCTAAGTTTCCCACCATCATTTTGCATTTGGCTATATTTCATGCTGT TTCCATGTTTTTGCTGGCTTCATTTTGAAACTGGGTTTTGTACCCTTAAA GGTCATGATAGTTTTGTCTTCATTCTGGGTTATACCTCTTATCTTTAAAA AAAAAAAAGTGTAGTTTTTTTTTAACTTTAATATTTTTACTTTAATTTCT ACTTTTTGTGATGTTAATATATACACTTGTTTGGAGCTTCCAGGTTAGTA AATCATGGCAGCTCTGAGAGGGCAAGGAAGCTCACGCCAGTACCCATATC CTTGCCAAAACATATTGTACCATAAACCTCTTCCCACAAGCCACAAAGCT CTATCTACACTGGGCGGAGGTGGGTGTCCTCTCCCATTATGCCTCAGTTG GCACCTTTTGTCACTTGCTCACAATAAGCCTATCTTTACTTCTAAAATGA TGGAGTGAAGAGTTGGAGACAAAATGGCAGAGTGGAAGGACTTGACCTCA CCTCTTCTCCCCAAGACACCAAAATCAAAACTAATTGAGCAACAACCATT AACAGAAAAACTCAGTCAGTTAGTCAGTTCAGTCGCTCAGCCATGTCTGA CTCTTTGTGACCCCGTGAATCGCAGCACACCAGGCCTCCCTGTCCATCAC CAACTCCCGGAGTTTACCCAAACTCAGGTCCATCAAGTCAGTGATGCCAT CCAGCCATCTCATCCTCTATCATCCCCTTCTCCTCCTTCCCCCAATCCCT CCCAGCATCAGGGTCTTTTCCAATGAGTCAACTCTTCGCATGAGGTGGCC TAACTATTGGAGTTTCAGCTTCAGCATCAGTCCTTCCAATGAACACCCAG GACTGATCTCCTTTAGAATGGACTGGTTGGATCTCCTTGTAGTCCAAGGG ACTCTCAAGAGTCTTCTCCAATGCCACACATCAAAAGCATCTCAGCTTCA GCTTTCTTCACAGTCCAACTCTCACATCCACACATGACCACTGGAAAAAC CATAGCCTTGACTAGACGAACCTTTGTTGGCAAAGTAATGTCTCTGCTTT TGAATATGCTATCTAGGTTGGTCATAACTTTCCTTCCAAGGAGTAAGCGT CTTCTAATTTCATGGCTGCGATCACCATCTGCAGTGATTTTGGAGCCCAG AAAAATAAAGTCTGACACTGTTTCCATTGTTTCCCCATCTATTTCCCATG AAATGATGGGACCAGATGCCATGATCTTAGTTTTCTGAATATGGAGCTTT AAGCCAACTTTTTCACTCTCCTCTTTCACTTTCATCAAGAGGCTTTTGAG TTCCTCTTCACTTTCTGCCATAAGGGTGGTGTCATCTGCATATCTGAGGT TATTGATATTTCTCCCGGCAATCTTGATTCCAGCTTGTGCTTCTTCCAGC CCAGCGTTTCTCATGATACACTTTGCATATAAGTTAAACAAGCAGGGTGA CAATATGCAGCCTTGATGAACTCCTTTTCCTATTTGGAACCAGTCTGTTG TTCCATGTCCAGTTGTAACTGTTGCTTCCTGATCTGCATACAAATTTCTC AAGAGGCAGGTCAGGTGTTCTGGTATGCCCATCTCTTTCAGAATTTTCCA CAGTTTCTTGTGATCCACACAGTCAAAGGCTTTGGCATAGTCAATAAAGC AGAAATAGATGTTTTTCTCGAACTCTCTTGCTTTTTCGATGATCCAGTGG ATGTTGGCAATTTGATCTCTGGTTCCTCCACCTTTTCTAAAATCAGCTTG AACATCAGGAAGTTCACGGTTCACATATTGCTGAAGCCTGGCTTGGAGAA TTTTGATCATTACTTTACTAGCGTGTGAGATGAGTGCAATTGTGTGTTAG TTTGAGCATTCTTTGGCATTGCCTTTCTTTAGGATTGGAATGAAAACTGA CCTTTTCCAGTTGTGTGGCCACTGCTGAGTTTTCCAGATTTGCTGGCATA TTGAGTGTAGCACTTTCACAGCATCATCATTCAGGATTTGGAATAGCTCA ACTGGAATTCCATCACCTCCACTAGCTTTGTTCGTAGTGATGCTTTCTAA GGCCCATTTGACTTCACATTCCAGGATGTCTGGCTCTAGGTCAGTGATCA CACCATCATGATTATCTGGGTCATGAAGATCTTTTTTGTACAGTTCTTCT GTGTATTCTTGCCACCTCTTCTTAATATCTTCTTCTTCTGTTAGGTCCCT ACCTTTTCTGTCCTTTATTGAGCCCATCTTTGCATGAAATGTTCTCTTTG TCTCTCTAATTTTCTTGAAGAAATCTCTAGTCTTTCCCATTCTGTTGTTT TCCTCTATTTCTTTGCATTGATCGCTGAAGAAGGCTTTCTTATCTCTTCT TGCTATTCTTTGGAACTCTGCATTCAGATGCTTATATCTTTCCTTTTCTC CTTTGCTTTTCACTTCTCTTCTTTCACAGCTATTTATAAGGCCTCCTCAG ACAACCATTTTGCTTTTTTGCATTTCTTTTCCATGGGGATGGTCTTGATC CCTGTCACCTGTACAATGTCACGAACCTTTGTCCATAGTTCATCAGTCAC TCTGTCTATCAGATCTAGTCCCTTAAATCTATTTCTCACTTCCACTGTAT AATCATAAGGGATTTGATTTAGGTCATACCTGAATGGTCTAGTGGTTTTC CCTACTTTCTTCAATTTGAGTCTGAATTTGGCAATAAGGAGTTCATGATC TGAGCCACAGTCAGCTCCTGGAACCTACCAAAAGAGATATGCTACATCAA AAGACAAAGGAAAAGGCACAAGGGACTTCCCTTGTGGTCCAGTGCTTAAA ACTCCACACTTCCACTAGAGGGATGTGCGTTTGATTCCTGATCAGGGAAC TAAGATCTCATATCCCACATTCCATGTGATGTGGCTAAAAAATAATAGTT AATAAATAACAACAAAGTGTTGCTTTATTTTTAAGAAAAGAAACCATGAG ATAGTAAGAGGGGTACAGTCATGATACAGTCAAATCCCATACCAGTCCAC AAACATGAAAAATAATTATATCATAGAGGTTCTGCCATAGAAGTGAGTTC TGAGCCCTCAGCCTGGGGGTCTGACACTGGGAGGAAGAACCCCAAGAAAA GCAAGCTTTGAAGACCAGCAGAGCTTCATTGCAGGAACTCCATGGGACTA GGGGAAATAAAAACTCCACTCTTGGAGGGTATACACAAACTCTCATGTGC ACCAGGACCCAGGGAAAAAGCAATGAATATTAGCCTTCATAGGAGCCTGG GCAGGACCTACCTGAGGTCTTGGAGGGCCTTCTAGGGAAGTGGGGATTGG TTGTGGCACACTATAGGGACAAGGACACTGAAGATGAAGGTACCAGTGAG TATTCATTGGTGTGAGCTCTCCTAGAGGCTGCCATTTTGATACCAAGACC TGGCCCCATCCAGCAGCCTGTAAGTTACACAGCTGGGACACCTCAGGCCA AACAACCAACAAGGCAGGGGCTCAGCATCACTCATCAGCAGACAGACTGC TTAAAGTCTTTTAGAGCTATAGCCACTTCTACACATATCCCTTAACAATA CCAAGCTGATCAGAGAGACAAGACTCAGCCCCATCCACCAGTGGGAAGAT ACAAATCTCTCCTATCAGGAAGCTTTCACAAGCCTCTTAGACCAGCCTCA CCTAAGCAGGGGCCAGTCACAAGAATCAAGAGGAACAACAATCATGTAGC CTGTGGAATGGAGACTGCAATCACAGGAAATTAGAAAACATAAGACAGCA GAGGAATATGTGACAGATGAAGGAATAACCCCCTAGAAAAAAAAACTAAG CAAGGTGGAGCTAAGCAATCTACTTGAAAAATAATTCAAGCTAATGATAT TAAAAATGATACAAAATCTCAGAAAAAGAATAGAGGCATAGACCAAAAGA TAGAAAAAATATTTAACAAAGGGCTAAAAGATTTGAAGAACAAACAGTTG AACAATAAAATAGCTGAAATGAAAAATACACTAGGAGAAATCATTAGCAG AGTAAAGAGGCAGAAAAAGGCATAAGTGAGCTGGGAGATAGATTGGTGAA AATAACTTCAATGAACAGAATAAAGAAAAAAGAATGAAAGAAATGAGACA GTTTGAGAAACCTCTGGAACAATATTAACACATCAACATTCTCATTTTAG TGATCCCAGTAGAAGAGAATGAAAAAAGGCCTGATAAAATATTTGAAGAG ATAATAGCTGAAAACTTCTATAACATGGGAAAGGAAACAGTCACCAAAGT CCAGGAAGCAGAGTCCCATACAAGATAAATACAAGAAGGAACATGCCAAT ACAAATATTAATCAAATTGACAAAAATTAAGGAAGAGAAAATGTTAAAAG TAACAAGGGAAAAGCAACAAATAATATACAAGGGAATCACCGTAAGGTTA AACTCTTCAGGCCAGAAGAGAGTGGAAGAATATATTTAAGGTAATAAGAG AGAAAAACTTAAAACCCAGAAAACTCCATCCACCAGGGCTCTTGCTTAGA TATGATATGGAGATATTAACANGTTTACAGGCAAGTAAAAGCTTGTAAGA TTTACCAGCACCAAACCATCTTTTACCACAAATGCCAAAAAACTACTCCA GGCAAAAAAAAAGGCCATGACTAAAAACAGAAAATCCCAAATAAAAAAAT TCACCTCTTGGTGGGAAAAAAAAAAATGAAAATCTTTCCCAAGGCAAAAA AAAAATATGAAGGGGACTAAAAGAAGCCCAAGAATAAATAAAAAAAAAAA ATTTGCGGAAAAGGAACGGGGTTTTGAATTTCCCGGGAAAAAAGGCCCGG GTTTCAAAACAAACCCCGGGGGGGGGGGACCCCCTACGCCCCTCCCCCAA GTCTTTTAAAAAAGGGAAAAAAAGGGGGTGGGGGGGGGTTTTCTTTCTCC TTTCACAATAAAAACAAATTTCCCGT project fbns AE 20040903 9961bp AAGGTCTGTGACGCAGTAGTTCTCACTACTCTTCCTCTTCATGTCCTCCC AGCTCTGGGCTTTGCCTCTGAGCTTTCCGGCAGCTCATTTCTTACAGTGA GATCATCCATCTCCATCTCTCCCTCTTTGATCTGGTTTTTATTTCTCTGT TTACTAACATGTTCGGATCTGCCTTTAAAATGAACTCTTCTCTCCTTGAG AATAGTGAGAGATTAAAGCTAAGGCAATGAATAACAAAGAAGCTTAATTA TAACCAATATATGCTGAGCACTGCACATAAGTTATATAAATAACTTCTTA AAACCATGTAACAGAGATATTAGTACAGGCTGTTTTATGGATCAGAAAAT AGAGATAATGAAGACTTAAAGACTTTCCAAAAATCATACAGCTAATGAGA AACAGAGCCAATAAGATACTTGATGACTTGACCCCCAGGTATGTCTCAGA CAGTAGGAAGAATCACACGAGAGGTTCAAGAAAACAAAATCTATTTTACT GACAGGTACTAGAAACAGTAGGCATGGCACACCACACAGGACCATGTGGG GAAGTCCCAGCACTGGTGAGGAGCAGAAGGGGACAGAGAGAGAGCATGGT CTAGACTCTTTACTGGGTTTTCACTGGAAAAGTGAAAGTGAAGTTACTCA GTCGTGTCCAACTCTTTGCGACCCCATGGACTGTAGCCTACTAGGCTCCT CCGTCTATGGGATTTTCCAGGCAAGAATACTGGAATGGGTTGCCATTTCC TTCTCCAGGAGATCTTCCCAACCCAGGGATTGAACCCAGATCTCCCACAT TGTGGTCCCTAATAGGCTGGCACTTGGCTCTGGGATGATAAAGGCAGAGA AATATTGTTTCCTGGTGTGAAGAATTGATGCTTTTGAACTGTGGTGTTGG AGAAGACTCTTGAGAGTCCCTTGGACTGCAAGGAGATCCAACCAGTCCAT TCTGAAGGAGATCAGCCCTGGGATTTCTTTGGAAGGAATGATGCTAAAGC TGAAACTCCAGTACTTTGGCCACCTCATGCGAAGAGTTGACTCATTGGAA AAGATTCTGATGCTGGGAGAGATTGGGGGCAAGAGGAGAAGGGGGCAACA GAGGCTGAGATGGCTGGATGGCATCACTGACTCGATGGACGTGAGTCTGA GTGAACTCTGGGAGTTGGTGATGGACAGGGAGGCCTGGCATGCTGTGATT CATGGGGTCGCAAAGAGTCAGACACGGCTGAGCGACTGATCTGATCTGAT CTTATCTGAAGGGCTACATAGAGGAGAAATGGCTCCAAATTGGTTAGTGT GTATTTTAAAGGTCTTCTCCCTACTAATTCCTTTGTTATCTTTAAGAATT AGCTACCCCTGGTGAGAGGCAGACTCTCCCCTGCCAGAAAGTTTTAAGAT GTCAAAACATCACATTATACAGAAAATAAAAAATATAAACAGTACACTGT GCCAACTCCTTCCTGGCAGTTCTCAGTGCATATTTTACAAGCCAATTAAA CATCTTTGTCACTGAATCTGAATGAATTCTGCCAACTTGTCTACTTATTG CTTCATTTGATTATGCATGGTATCTAACAAAGCCTCGATTGCTAAGTAAG GAAATAATAGGAAGAAAGTCTCAATCTTGCTTAAGTAATTAATTTCATCA GCCACAAGACAGGAAGGCCAGAATGAACTAGCTGACTGAGCCAGGAACGT TGAATAGTGATACTGATGCTAAGTTTGTGTCTTAGTGTCAGGTCAGAGCA AATGAACTTGGGCATTTTCTAGATTAGCATAAGTTAGCTAGCTGAGAATA CTGAAAGTAACAAGGTCTGAATATAGCACTCTTAAACAGAGCTTAATTAC ATATTTGTAGAGGGGAAAAAGTAATCATCATCCCTTGTGGCTCAGACGAT AAAGAGTCTGTCTGCAACGTGGGAGAGTTGGGTTCAATCCCTGGGTCAGG AAGATCCCCTGAGAAAGAGAATGGCTACCCACTCCAATATTCTTGGCTGG AGAATTCCATGGACAGAGGAGTCTGGCAGGCTACAGTCCAAGAGATCGTA AAGGGTCAGACATGACTTTAGCGACTGAACAACAAGAGGGGAAGAAACAA TCGTGACCCATTGAGACGGGTGCCTTCCCACAGCAGCATATCTGGAGTAT CTCTGGGCTACCTTCCCTGTGCTCTGCTTTTCACATTTTTATAACTTTTA CATATTTTAAAACATTTTAACATTATGTGACTTTTAGGAGAAGGGGGAAA AGAAAAACCCAAATTCTCATCTCAATTAAAATTGTACCAAGTCTGTGATT ACCTTGTGTGCCTCTCTCCATGGATATTTTTCTTCACACATTCAACCAAT ATCTTCAGAAATCTCAATTTCAAACACTCTCCTACCACAGTCACCTCTCT ATCTAATTCATTTAATTTAGTGTTCCTAAACCAACCATTTTTCACATGCA TTGAGAACGCTAATCCTTTATGTTGACCATATTTTCATTCTCATGCCATT CATATCTTTACTTCTCTCATGAACCAGGAAAGATTCATTCATTTAATCAC CTTGGGCAGTTTCTTAATTCCATAAACCATCTTTCCTTTCATTACTTTAC ATGTCTGAGATAAATGCAATGACTTATGCTCTACATATACCAAACAGGAG AAAAATCACATAAGAGTGATAACTGGACTCAAATTTATAACCAAAAATCT AGACTAGACTTCACCTCTGCAACTAATCCAAAGTAGTTATTTGAAACATC AGTCTCCTCCTTGCACATCCACTGATGGCTTTACCTTTTACCTCTTGATA ACATAGAGGCTATAAATAGGAAACTCCCTTCCCTTCTGAGGGGTTCCCAG GTGGTGCTAGTGGTAAAGAACCTGCCTGCCAATGCAGGAGATGCAAGAGA TGCAAGTAGGATCCCTGGGTCGGAAAGATCCCCAGGATGGGAAGATCCCC AGGAGAAGGGCATGGCAACAGACTCCAGTATTCTTGTCTGGAAAATTCCA TGGGCAGAGGAGCCTGGTGGGCTATAGTCCATAGGGTTGCTTCCCTTCCA GACACAAACAAGTCCCTGTATCTTTCACTTCCCTCTTTGCTTTCCTTCCT CTTACTCAGGCATCCCTATTCCCAAGATAAACTCCTCCACTCTTTCTCTG GATCCCACTGACATTTACTTTTGCAAAAAAATTGAGTCATTCAAACTACA TTAGCTATTTCTCTCTATATCCATCTAAATATTTTATTAAAGACTGAACA GAATCAGATTGATCTAGGATTGAGGGTGTAAAATATAAGAAAATCAAAGA TACTACTGAGTATAGAGAGTTAGTGAAGATAGTTCAAAACTTGAAATTGA ATCCCAGAGTCAAAAAATAATGTGTATAGAGGAAGGATTTAAGACCCAGA GGAAATAGTTTAAAAAATGAGTTTTTTGAAACACTAATTTTTTCCAAGGT AAGTTTCCTCTTTTTGACTGTGGAAAAACACAACAACCGTCACCCAGTTC ATTCTCCTTGGGCTGTCTGCTGACCCCCACATCCAGGCTGTGCTCTTGTG CTAGTCCTGGGGATTTACTTCCTAACCCTGATGAAGGATCAGGTGATGCT TCTGCTGATCAGTGCTGATTACCATTTCCATGTACCTATGTCTCCTTCCT GGACATCTGCTACTTCTCAGTCTCAGTGCCCAAGTTTATGGAAAATCTCT TGTCTGAAAAGGAAGCAGTCTTAGTAGCAGGTTGTGGCCCACATTGGTAT TTGCCTCTGAGGGCACTGAATCCTTCCTGCTCTTAGCAATGGCCCAGGAC CACTATGTTGACATTTATCATTCTCTGTTATTGAGTCAGGTGATGAGAAA CCAGCTCTATGTGGGACTGCTGTTGGCCTCATGGGGCCTGGACTTTCTGG ATGATTGCATCAGTATCTTTGGAGCTGCCAATTTAGAGTTTTGTGAGACC CATACTATCGCTCACTTCAGTTGTGAGCTGCCCTCTCTCTTCCCTCTGGC TTGCTCTAATATCTCCACCAGTCTAACTGCCCTGGCCTGGTCTTACGTCA TATGTAACCGTGGAACTGTCCTCCTTTCTATGCCTACATTGTGTCTACCA TTGTGAGCATCAGCTTCATCACAAAGCAGAAGTAAGGATTTCTTCATCTG TACTTCCTACCTCACTGCAGTCATCTTGGATAAGTCTTAAATTTTTCACT TGAGCAAGTGGATAGATGGTAACATCGTTTACTAAAATAAGCATGACTGG GAGAATTGCATATTAGGAGGGTGAAGATTAAGGATTTGATTTTTATTAGT TTTGCTGGTTGGTGTGTTGCATTTTGGCTAAACTGCTTACGATGCTTATT AGACATCAAAGTGGAAAGTCAAGTTGAATGTCAAGTTAATGGTCTAGGGA GAGATCAGGGCTAATATTTGGGGGTATATGTGGTATTTTGAGATATAAGA TTAGCACAGAACATCTAAGGAAAATGAAAGGAAGAGAAGGTTCTGGGAAT TAGCTCTGGAGCACTCCAGAATTTATAGCTCAAGTTGAGAATGACCCAAC AAGAGAAACAGGAGTAGCAGCCATTAAGCAAGAAACAAAATCAGGAATCT TTGTGTCACAAAATCAGAGGAAAGAGAATGCTACAAGGAGTATAGAGAGG TCAGTTGTGTTGGCTGCCATTGAAAATTCAAAGAAGAAGAAAACAGAAAA GTTACCATTGGATTTTGCAACATTGACTTTGGAAGTTGTTGGCAATATTG ACAGGAGAAGTTTCAGCTAGCTGGAATAAGATGAGGAAAGAATGGCAAGT GGAAAAGTACAAAGAGCAACCATAGATAACTTTGTTGAGAAGTTTTACTG TGAAGGAGATTGAGAAAATGGAGCAGCAGTAGGTTTGAGGAAAGTCGAGG GGTTTTTTGTTTCTGCTTCTTGCCTTTGATTTTGCTTTGTTTCTAAGAAG AGATACTAAAGTTTGTTTAGGTGTTTGTGGAAACGGTCACATAGGTAATG CAATATCAAAATTTGGGGCAGGATTATGGCAAAGAAACTTAAACTGGTGT AATAGAGTTCCTGAGGAAATTCAAACAGAAGTGAATGGTCACTTAATGGG AGATGCTGTATGGGACTCATGCATCAGGTTGGAGATTGAAATAAAATGAT CCATGCTATCCTTTATGCTCCATAGAATTCTGTGGAGAATAAAAGTAAGG TTTCTAGAATTCTAAAAGCATTCTAAAAGAATTCATAGAATTCTAAAAGT AAGGCTTATTTGTTTGCATATAAGTGAGAGAGTGTGGGTAGGAGTATGTA TGCCTGTAAGTGCACATTAAGGTCAAGTTTTGTCAAACCTGAGGAAGCCC CAGGCTGCTCTCTGGCTAGCAGAAGGGTTTACAAGCCCTCCCACAATAGT GGCAGGAAAGCCAGGGGTCCAAATGACTGACTACTGCTGTTTTCCCATGA GTACAGATTAATTCCCAGCTCCCTGGGGCCCTCATTGCTTCCTCTCACTC CAGCCTGGCATATGGATACCAAGTAGAAAAAGGTTAGAGAAAATGATAGA AGTCATACAAACTGGCCAGGAGCCCTCCTTAGAACCCAAAGAGAGAAAAG AGGAAGAAAAATGAAGAAAAGGAGGATGGCTAAAGCTTTTTAACAGGTAC GGACTCAAACCAGAGCCCATGCATCCCAACATTTTAGTCTTTATCCAAAA CTAAACATAAGATGACTATTTGCATTGAACACAGTTTTCAACTTGTTGGG GGAAAAAAAAAAAACAGCTTTTCCTGGAACCTGAGTTTTTTGAGCATCCT ACATCATTCATCTTTCAAAGTGACACAGAAGGCAAGTTAGAGTGAGACTC CACAGTCCTTCTCAGTCCCCAACCCACCAGATGTGAGGGATCTTACTAGG CAACTGTTCCAGACCTTTCATTGCACATTAGGGAGAACTGAGTTTAAGAA GAAGAAGAAGCAAAAAGTGCCTTGCCAAATTCACAGAAGCAGGCCATGAC AGATCTGGGATGAAATATTTACAAGATTGAGTAATTTGTCACTTTATTAA TCCATAATCTGTCCTTTCCCTTCACTTACAAAATGAAGTTTATAATTCCT TTGAGATGGATTGGATGAGGGAGCTATAATTTCTGGGTGGGCAGCTGAAT GGAACATTTTTGAATTATGGGTAGTAACAGTGAGTTTGGAATAGTCTCTG ATGGAAGATTTCCTAGCTAAATGCCAGAATCTTAAGCTGAAAGTAATTTG AGAGGACATTTAGTTCATGGGCTTCCCTGGTGGCTCAGACAATAAAGAAT CTGCCTATAATGTGGGAGACCTGGGTTCAGTCTCTGGGTTGGGAAAATCC TCTGGAAAAGGAACTGGCAACCCACTCCAGTATTCTTGCCTGGAGAATCC TATGGACAGAGGAGCCTGGCAGGCTACAGTCCACGGGGTTGCAAAGAGCT GGATAAGACAGTGACTAACCCTTTTTGTAGTTCAGGGCCCCATCTCCAAG CAAGACCAAATCTGTAGAAAGCACAGCCAAATTGCACAGCTCCTTAGAAT TTTTCAGAAACAAAACAAAATCTGTAACTCTCCTTTTCATTCTTGTCACA AAACAAAATTTTTTGAAAGTTTTCGTTATCTAAAAGCCTAAATGGCTTGT AGCTACAAAGATTTGCTCAGGGAGCAAAGTCTGCAACTAGCATGAGAAAA GGAGAAGAGAGAAAATCTTTGATATCCTTTTCTTCCTATTCCACAAGAGC ACTGTTCCTCTTGTCTTCGCTTCCAGACGTTCTCTTCCCTTCAAAAGCTT GTTTCTTTCCTTTTTAAAATATGTATATTTTAAAAATCTTTATTGAATTT GTTAAAATATTGATTCTGTTGTTTATACTTTTTTTTTTTTTGGCTACAAG GCCTGTGGAATCCTAGTTTTCTGACTAGGGAATTCCCTTTCTTTCCTTTT CTACCAGGGACTTTTCACTAGCCTTCAGCCTTTGGCCTCAGGACCAAATC CTCCAGCAATGTCTCCTAGACCACAAATTTGGGATTAAGGATCTGGTAGG GAACATACAGTACTAATAGTAAACATACAAAACTAATTAGTAAATATACT AATAGAAAAACCAAACTACTTGAGCCATTTCCATTCTTCAGCTGAGCCTC TAAGACACCTTCTTAAGAAATGGCTTCTCAGACCAAGTTCCATCTTGTTT GAGACTATAAAAGGCAGAAATATGGTGGGAAGAGAAGATGCATATATTTT GTTGGAATTTGGCTTAATTAATTGTTGAGTTTGAAGCAAAAGGGTAGAAT GTGGATTGCTTGTTATCCCCATAAAGATATTTTTCATTAAAAGTATAAAA ACCATGTTGTTAAAAAGGCAAAATCATGACAATAGTTCACTCAGCTATTT ATTTTTCCATTGATAACTCTACATAAGCCCCTATTATATGCATATTTTTA CATAATTTAATGAATTCATACTAATCAGGTATTCTGATCTTTTTACTAGA TATCATGAATATTTTGTTTCTGTCTCTCCCCTATAATTATTATTTTAATC ATTAGGTAATATTCTGCATTTGTTTCTACAACAATAGAGTAGCTATTCAC CAGTTAGTTGATCTTTTAGATTGATCTTGAATTATTGTCTTGAAAATAAC CCTGAATATAATTTTCATACATTCCTCTCCTTTGAATTATTTAAGACAAA TTTCCAAAAGAGAGAACTTAGATTTCACATTGCAAAAATTATTGTACCAA ATATAATATTATGAACAAGGTATAAGATCATATATGACTCACCAAATCTT GCCAACACTGGATATTAGAATTTAAAGTAGCTAATTTCCATTTAAGTGGA TCTGCAACACTATCATCATCTGGCTTCAATTTACAAATAGAGCAGAGGTT TCCCATATATTTTTCTAGTATATGCCTAGGAGTTTAGGCTAGTCATCCTT CACCACTTAAATTTTGTCCAAAGAATTGCAGCAGCTAGAAACCATGGCAG AGAGAACCGGCATATGGACAGGTCAGAAAGCTTCTGGAGTCATTCAATGC TAGATGATGAATCCCAAAGTGTAAATACTATAGAGGAATAGGGAAATTTT AAAATATTGAGATGACAATGAAAACAAAATGTGTTAGGTAAAAACTGGAG AGACCTCCCTGTACCCAGCAGTATGCTTAGACTAAACTAAGAAAAATCAA TTGACTTGTTAAAGATCATGAGCTACTTATGTTAGTTCTTGTCTGAAATA GTGTTCATACATTAGTAAATTGCTTTTGTTTTGCAATCAATTTTATTCCA TTAAGGATGTGTTGTTATCCCTCTTTTTTCCAACAGTGTAACCAGTCTTC CCTGAACTGGCAAATACTAAGTTACCAAATTAAACCAACAGTTGTTGGTA TTAGGACCAGACTTTAAGGCCTATTTCTATATAGTTCATCATGTAAACCT TGGTAGATAACACAAATAAGAAAACAGAGATTCAGATTCAGATTTACCCC CTTGCCCAAAGTCTGACTGCCTGCAGAGTAGCTGAGAATCCCATCAAGAT CCTCTGACTCTGTTCAGGCCCATTACCATCCATTCAAGAAAGCCACAGAG ACCTCAAACTAACTCCCTCCTTCAAAGAGCTCCTTCCTAACCAGGCCATA GAGTGTATGTGACATCTCACTGCCAGTGCAACCTATGGTCTCACCAGTGG GGTTGCCTCTGGATCATATGATTATTCATTTCATTAATTGTTTTACTTAA TAATCAAAAATATTTTTATGACCTCCTATATATAGTATAAGGCTTACCCT GTGGCTCAGATGGCAAAGAATCTGCCTGCAATGCAAGAGACCTGGGTTCA ATCCCTAGATTGGGAAGATTCCGTGGAGAAGGAAATGGCAGCCTACTCCA GTATCTTGCCTAGAGAGTCCCATGGACAGAGGAGCCTGGCAGGCTATAGT CCATGAGGTCACAAAGAGTCAGACATGACTGAGTGTCTAATGCTTTCTAT GCTGCTGCTGCTAAGTCGCTTCAGTCGTGTCCGACTCTGTGCGACCCACA GACGGCAGCCCACCAGGCTCGCCGTAGAACAAGCTTATGTAAAATCTAGC TTTGTGGTGTTTTTATATGTTTATTTTATAAGCCTTTACTATGGACCTAC TACACAGTGTAGTAGTAGTACTACTACTACACTAGTACTGTAGTAGTGTA GTAGTGTCTAACAGTGTCATACTTATTTTTGGGGGCTCCAAATCACTGCA AATGGAGACTGCAGCCATGAAAATAAAAGACCCTAACTCCTTGAAAGAAA GTTAAAAACCAACCTAAAAAGCAAATTCAAAGGCAAAACCTTTACTTTGC CAACCAAAGGCCCGCCTAACCAAGGGCAATGATTTTTCCAAGGGGCCATG GATGGAATGGAAAAATTTGAAATTGGAAAAAAAAAGGTTAAAAGGCCCCA AAAAAAAATAAAAAGCCTTTTCAAACGGGGGGGGGGGGGAAAAAAAAAAT TTGGAAAAACCCCCTTGGAAGCGGGAGGGGAAAACCCCCCCCCCCCCCTT TTTTAAAAAAAAAAAAACCCCCCGGGGAAATTTTTTTTTGGGAAGAAGGG GGGGCTTAAAAACCAAAAAAACCCCCCCAATTTTTGGGGCCCCCCCCCCC CCGGGAAAAAAAAATTAACCCCCCCCTGGAAAAAAAAAACCCCCTTTATT TTTTGGGAGGAAAAATTTGGGGGGGCCCAAAAAAAAAAAAAAAAGGGGGG CCACCCAACAAAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGGGGGGCC CCCCCCCCCCCCCCCCCCCCCGGGGGGGGGGGGGGGGGGGTGTATTAAAA AAAAAAAAACCCCCCCCCCCCCACAAATTTTTTTTTTTGAAAAAAAAAAA AAAAAAAAGAGAAAAAAGGGGCCCCCCCCCCAACAAGATTTTCATCAAAA AAAAAAAAATA project fbns AF 20040903 9437bp AGTTTGAGCAAACTCTGGAAGTTGGTGATGGACAGGGAAGCCTGGCGTTC TACAGTCCATGGGGTTGCAAAGAGTCAGACACGACTGAGTGACTGAACTG AACTGAAGAATACTAAAAAAACACCCTTAATTTCCAATTACATATCTTGT TAAAGAATAGTTTAGCTTCTTCATGGTCCTGTTTTTCTGGTTCTCTATGT GAAAAAGATACCATATCTTCTTAACATTCTTCTCACAGCTGCCTTCACCT CCTTGTTCTGCAGGCTTTAGATGAGAGGATTCAGTATGGGGGTGATCACG CTGTATTGTAAAGGGAAGATCATCTCTAGGGGGGAACCTGAGGTCGGCAA CAGATAGCTGAGGAAACCTGAGCCATAAAACAAGATCATAGTAGTGAGGT GGGAGGAGCAAGTAGAGAAGGCCTTACTTCTGCCTGAAGTGGAGCTGATG CTCAAGATGGTGGAGTTAATACAGGTATAAGAGAAGAAGGTAAAGACGAA GGTTCCAAAGAAATGTAAGAATGAAGAGCAGAGCAGGAGCGTGAAATTGG TGGAGGTATCAGAGCAAGACAGAGGGAAGAGAGAAGACAGCTCGCAGCTG AAGTGGGGAATAGTTTGGTCCTAAATTGTAGTAGTCTAAATTGACCACCA GGAGGATGTTGATGAGAGCATCCACAAAGGCCAGGCTCCAGGAGCCCCAC ACCAGCCCAACACAGAGCTGGTTGGTCATCACCTGGCCGTATAGCAGAGG GGAGCTGATGGCTACGTAGCGGTCATAGGCCATCACAGCCAGCAGACAGG CCTCAGTGCCCCTGGTGGTAAACACAAAGAAGGCCTGAGCCAGGCAGCTC TCTACACAGATGGTTTTACTTTCAGAAAGTAGATTTTCCAGCATCTTGGG GACTGTGACAGATGAATGGCAGAGATCCAGAAAGGAGAGCTGTCCCCAAA AGAAGTACATGGGTGTGTGGAGGTGGGGATCAACCCTGATAACCAGCAGC ATCACCAGGTTCCCCATCAAGGTCCGGAGGTAAATCACCAGAAACAATGT GAAGAGGAGAATCTGGGTCTGAGGATCAGCAGAAAAACCGAGGAGGATAA ACTCACTGGATATGCTGTGGTTTCCCATAGCGATAAGATTTACCCTAAGA ATCCAAGAAAGAAAGACTTTAAAACTCCCTTTGTGCCTCCCAGTTACCAC ACTGCCTTAGCCCTCTTGTTCATTTATACCATTTCACAATGGTACTGGAA ACCATGTTCACATATTCCTAAGCTAACTTCCTAATCATCATGATAACTTT GATACTCCTGGATGGCAATCCACCACCCCTCTATCAAATCCCTATGTAAA TTTGTGGACTCTTGTCTTACATCTCTGGAAGTTTCTTTAAGATGGGTATT AATATAAAGAACACTTTGTATAGTCAATGGGAATAGAGAGAGAATTTTTG ATGCAGCAGAGCAAGACATGAACAGCAGAAGTGTAGTCATTTAAAAAGGG AAAAGGAATAAGATCCAGGCAGGACAGGTGGAGTTTTCTCCATAATTAGG AAGACAGGCACTTTATCTTTTGTAAACAGGAGGGAAGGTAGAGTGAGTGG GGACCAAGGCAGCTAGCTTGGAGGATTTTATGGATGAAATGAGAGACTTT CTGACTGTTGCAAAGTTTTGTAGAATTATGAGATGAGATCATGAACAGAA TTTGCCTATCTATCTATGCATGTGTGTTGTGTGTTTTTAGTGAGGTGGTG GTGAAAGATATTGATGAACCAAGAATGCAAAACTCAGGTACACCAAATAC CTGAGACTAATTTATGAAGGAAATACAGTAGGGTTAACTGGTGATGTGTT TGCCCATTTGACATGCTGGGACCAATCTGAACAAGCATCTGAACAAGTAA TATTTAGCTGCGTAAGCACCATGTGTAGAACAGATACATATTTGGTTTTA AATGGAGTTTTGTTTTGTTTTCTTTTTACAGCCTTATGTAGTGATAAAGA CAAAAAGATGTAAGGAAGAAGCATGCTAGCAAGTGAATGAATCACAGAAA CAAGGCTGTGCAGGGAATTAAAAGGGGGGCCAAGCCAAGGAGTATGGCTA GGGGAAAAGCTGTAAAGTCATTGGCTTGGGATTGAAAAACTGCTTATGTA GGAACACTAAAGTAAACAAATTGTAAGATTTGGAGATAATTATTAAAGGG ATGCTTGAAATTCAGATTTTGTAGGTATAAGTGCCGGGAGCCAGCGTGAG GAACTCCGCCCATGGCAAAGGTCATGAAGAAGGAGGCTCGGCATATGCAA AGGCAGGATAGAGCCTCAGGAGTCCCCCTGGAAATTCTCAAGCATCTACC CCCAAAACCAGAGTCTGCCTACTTTACTGCTTTGTGCTCTCACCTACACC TCTGACTTTATGGGGGGCTGTCCCCCACCACTTCTCTCTGAAAAAGAGTT AACTTACAGCTCCAGTTAATAAAGTTCCTGGGCGTGACAAGAGTGTTTCA ACCTACAAACTCCTTTGGAAGTCCTCTAGCCTGCCTGAATAGGTTCTTCC GGCCACATGTGATTGTTCAGAGCCTCCCAACCATGAGAGGCATGAGATGT TCTAAACTGTCTAAATACAGATTCCTTTGAGCAGTTAAAAGATTGATTAG AAATTGTATTGGTGAAGGGTTTTTCACTTGTTGGGCCAATGTTTGCTGCT AAGTTTCCATATCCCTTACCTACTGTGTCCCTGAGAGTGTATTAATTAAT ATAATTGGTGTATAGGAATGTAAGTAGTAGCTTTAATGTTTGTAACCTTG GACCCTTGAGTTAATTCTTTTCTTGTTACAGCCCACCACACCTTTGCCCT ATAGGAATGCAACTTTATCTAATGCTTTCGGAGGGTGGCACCTGACTTTA GAATAATCACCTTTAAAGAAAAATAAGTTTTCTGAAGAAAGGATCATAAA ATGTTAATAGGCCTCTTGGCCAGAAGATGATGTAAATCACCTAAACTTTT GCATATGATAAGTTTGCAGGAAGAAAGCCTGGCTTACTGCTGACTCTACC TCTTCTCCCATTATCCTCTATGCACAACTTAAGGTATAAAAACTACTTTG GAAAATAAAGTGCGAGCCTTGTTCACAGAAGCTTGGTCTCCCCATGTTGT TCTTTCTCTCACCTTCTGGCTGAATTCCCATCTGGAGCATGGAGGCTCAT CAAGCCTACTAACATTGCCTGGGCTTCTAAGATCTGACTGGGGAGGCCTT AGTGTCTCCTCTCCTTCAGGAGAACGGGAGGATGCCTGCGGCCTACGTAG GTGACGCAAATTCCTTATTTTGGAATTTTATTAGCTTTCCACGTAAACCA AGTTATTCAGCCTCTTTCCTCCACTGAATTTTCTCACTGAGCTATCTTTA TTTAACCACTCTTTATACCTTTAATTCTATTGTATCCTGATCACCGAAGC TGTCTCCCCTTCGAATTCCCTGGATCCACCGGGGCTGGACCCCGGCATAT AAGTACTTCTGATGAAAAGTGATGGGTGTCACGGTAGCTAAGATGAGGTA GAAGGTTCAGTCTCTGGCACAGTAGAGAACAAAGTCTAGGGTGCTGAGCT AGTGGGTAAGGACTGTTTTCCTGTTTTATTATTTTTTGTTTTATTGTTTA ATTCTACTCCATTTTCTTTAATGATTACTTTTAAATTTAAATAGAATTTA CTGAAAAATCATTTCCATTTAAGGTAACCAGATGAATTATAAACCTAGTT GACTGTTGGAAGAAACAGCCACATATTTGAAAAAAGAAGCTGTTCCCTGC AACAGAGTAATAGCTGGTTGGATATTCTATGCCCAGCTTAAATTCCTTTT AATAGTTTTTTTTTTTAATTTTTAATTAATTTATTTATTTTACTTTATAA TATTGTATTGGTTTTGCCATACATTGACTTGAATCTGCCATGAGTGTACT TTTAATAGTTTTATAACCTGGCTCTGCATTGTCAATGTCTCAGCCAGCAT GGAAAGTCTACATGCCAACCCAACCTCATGTCACATTCCAAGACCTGCCC ATGTTCTGCTTTGTTCTGACATCCCTGACTTGTAACCTCAGACTCTGGGT AACTATTCTATAATGCTGTCCAAGTCTAGCCCACCCTGGCCTTTCCTTCT AATTCAAGACAATCATATTCAGCTGATTGAGGGAATTAGGGTTTCTCTTC CCTTGACTGCTAACCAAGCACTAGATGACTATGTTCAATTACATGTCTGA ATAACCAGTAGCAGCAGGTGGTGGCATCAATCTCAATCAATTTGAGATCC AGTGACAAATTATTCACATCCAGAGAAAATTACTCAACTTGTATAGTGTT GAGAATCCTATATTATAGCACAATGGGGCAGCTGAAATTGTTATATTTTG CTTATTAATTTAGATCTGGTCACAGTGTCCACTTGGGCTCCTGGTGTGCA GATCATCACACTATGTCCAGAGAATACAGGCAAAGCAGCTAGTATATAAC TGAAATATGAAATCCTTTATGTCTGGTAAAAAGCTCACATTACTAAGGGT GTGAACGTGTTGGGGCCGCTGTGCCTCTTTGACATGATTTCAGGGCAATA CAAAGAAAAACCCCTTTTATATCTCCAATCTCCACATATATCCTTACTTA TTGGCTCCAAAAGATTCTATAAATTATGGAGAAAAATTTACCCCTACAAC AAGGCGAAAGATGAGCTAAGCTTGCATAGTGTATTTGCACACATGAGACA CACTGACAAGAAGAAGAGTTTCTGTCCAGGGGGCTTGACTTCTGCAGAAG TAGAACATCGGATTTCTTTTTGGAAGAATATTTGTAGACACTCTCAAAAT AAATATGTAAAATAATAAAAACAAACCATATTATTGTGGCTGATGTTTAA AGTGTCACCATTAGTGATTTCTTTCTTCTGTTGTTTCTAAACATAAAATG TCAACACTTTGGAAAGCATGACATAGCAGTTTTGTTGCCAGATATAGTTC ACTGGATCCTATCCAAAGGAAAAACAGCTAAGGACTGATCATTACAGAAT GAAATATGACTTTATCTCATGTTTATCAGAAGATATTATCAGAGAACATT AATAAGTGTATGAATGAGTAAGGAGGAAAAGGAGAAAGTGGTTCAGTGTA TTATCAATGTGGGAAGATAAGCCTGATCCATAAAGAGCTTAAAGTCCTAG GTTTATGAAGAGGCACCTGATATTAAGGAAAAAACCTAAAACCAGAGCTA AGAAGGTATTAGAGATAGGCATAACCTATTTCATAATTATACTCAGACTG TGCCTTGATCTTGCCCCACTGGTCTCAGGGCTAGGCCATCTGAAGGTTAT TTGAATTGCAGATAAAGCAACTCCCCAAAGCTCACAAGACTACAGTTGAT GAGGAGACAGTTGAAGGCATGAAGAATGGGAAATGTACTCCTAATGTTTC ACCATGTCCCTATCTGGGTTGCTCTCAGCTTCTTCAAGATAAAACATAGA CTTTATGCCTGAAGTTCAACTAAGTGGACTGGAATGTTGCCAACATCCTG CAGTTTAGAGACAGACACATCTGGTATAACCCAATTGTGTCATTTACTTT CTATTTAACTTTCGTGATATTGCTTGGTATTTTAGATCATAATTTTTTCA CATGTGAATTGAATAAACTTGGGGGAAGTAATGTATATCTTACATTTGGA AGGATAGAATTAGCTTATACATAAAGAACTGGAAACAAGATTTCTGACAT ACTGTAATTATTAATGCATACCAGAAAGAGGAAGAAGAAGGATACTGCAG GGGGGAGATCAAAGCATCTTAGGGAAGAGATAATACGAAGTTGTTTGTAG AAGAGCTGTCCCTAGACCTGGAACAGTGTTTTGACAGGAGAGCAGTGAGG AGCTGAGAGGCTTCAAAGGGAAACTAAGTCTCTTAGGAAGCAAGAAGATA TGAAGGGAGTGAAGGGAAGAGGGAAGTACCTTAAAGAGTAGGTTAGGAGG GGAAAAAGCATCAGAGGATTCAGTAGAACATTTCATGCTCTTGGCTTCTC CTGGTGGAAATTATCCTGGAGCGTTGAGCCAACAGGTGAAGAGATCAGAG AACAAGTGATATTCTTTAGGAAAAGATGTACTGTAACTTCCCAATTCTGG GAGTAGACATAGTTTTCTTTTTAGGCAGCTGAGTGAAAGGGAGAGAAAAA AGAAATACATTAGCACAGTCTTCAAAAAGCACTTCACTGGTAGAGAAAGT GTTCAGAATCTTACTTGTGTTCTTAGCCTATTCTGGCTTTAAAGAAAAGA CAGGGAAAATATCTTGAAAATTCCAAGTTCTTGACAGGTTGTATTAATCT CTCTCATAGTGTCTTAAGCTTGATCTGGGTAGTAAGTACAAGATCATTAG TTCACACCTTTTCCTCAATGACTATAAATATGTTGCTGATAGCATCACCT GAACGAAGGATTCTGATGTCTAGCCAATTAAAAGAGCAGTTGGTTTAGGC TGAAGTTAGGAACCCAGCGGTTCCTTAGGAACCTGACTCAATAGTGTACA TTTGTAGGAATACGGATTATTGAGCTTGAAGCAAAAGTCTAGACTCATTT GCTAAGAAGCTTGAACTTTTAAAAAGTCATATGGGATTTTCTCATGTGTG ACCTTTTCAACTTGTGGACTGAAGCAATCAACTTGGACTCTTAGATGACC TTTCCTGCTAGTCTGCTGGGAACTGAAGAGAGGCATGGTAGAAGTGAATC TGGAACCTGTGAATAAGGCCAGAATTTCCCCTCAGGGACATAGAGGCCAT GTGGACCCAGAGAATTAACTTGGGATCTGAAACTAGACTCACAGCTAACC TCCAGATTATCTTCTCATGTGTATGAGAAAGTCAACTGGATTTAATATTA ATCAGCATTAATATTAATCAAGTGAGGTAACTTTTTAAAATTAAAAATTG ATGGCATCAAAGCCATCAGAAGGTCACATCAACCAGCCCACTGTCCAAGA ATGGAGTATTCTAATGAAAAGTAATGACTGAAATTGATTAAGATGCATTG AATATATTAAAATACATGATTTAATGACAATGCACAATCATTCAATTAAT GAATTGATAAAAGGATAGAAAGAAGAAGCCCACTGGACAGCAATGGAAGT TACACTGAAAGTTTATAATTAATAGGAAAGAAATGAAGTAGTTGTCATGA CTTCTGCTATGAATTACATTTCAGGGTAGTCAAAGAAACCTCAATGGATA CAAGAACTTACTTTATTTTCAGATGAAGTCCAGCTAATAAATGCAGAAAA GTAATAAAATTAGAAAATTACCATTTTGGAACTTCTAATAAAATAACTGC TCAGGCAGTGGTCATATATATGTAAATATATAAATATGTAAGTAAATATC TAAGTAAAAGAAGATTTGCAATTAAGAGATGTGATTATAATCACCCAAAC CAACTGATCAAGCCTGTCATCAAAATAAGTAGAATAACCAACATAATTTT TCCCTTGCTATAATGCAACATGAAGTTCACAAATCCACTTATGAAGATTT TAAGAAAGGACTGAAGTCTTAAGACAAAGTATGGGACAGGACAAGGTAAA TAACAACAATAAATCAAACTGGCTAAATCTAGAATGTAGATATTCCACAG GGAAACAGTATGGATTTCTCCAATAAATAGCAGCAGACACAGTTTTCAAA ACTGCTCAGAAGCTGTGAAGACTCCTGCCTTGCCAGTGAGGTAAGTTGCT TGCAGCACGCATGATGGCCCTTGTTCTCCTCTTCAGTAGGATCTCCTGAA TCCACCACCTTCAGCCTGGCTCTGCTCTCAGGAGTATTCCCTGTCCATTA TCCTGAACAGCCACGTCTGAGATGAGCACTGGAGAGAATGTCTTTCTGAG CAGCTGTGTAGCTTTCACTACCTACTTTTTGTTGGTACCTGTTGCTTCAA CACCTGCAATTTTCTTTGGGGATTGATCCAACACTGGTTTTGTAAGGCAT GCTAGTCCCTGTGTACGTAGGTAATCATAGCTCTAAATCTTCAATAGGCT TGATTTTTAAGTCTGAAGACCCTGTCATCTTAATTTTATTTAGCAAGCAT GCTCTGCGTCATCTCCTTGCACTCTTATTAGTTGGGCTGCCTTGGTGCTA TCTGACTCAATGGGCTTAAGTGAGAAGGTAGCACTCAAACCTGGCTTTGC CACTAGGTCTTTGTCTTGTTGCGTGAAAGGAATTTAGTCTTATCTTCTAT TATGGCTTTTGCATCAAAACCAATGCTTATTGCTGTCAGTTTCAGCTACA ATATGTCACTCCTGCAAGACTCTAAATTATAGAACTCTCAATTAATATAG ATTAACTATAGGCAGAAACCAACTTGATAAACTGTATTTCCTTTCACTTA TGCTTGGAGGCAAGAGTTTTGGCCAGAACTCATTTCTCACAGGGCTTTTC AGAAACGGGAAGTCAGCATCCATCAATGTCTCATATTTTTACTATCTTTT CCTCTAATGTTATGTCATCAGTTGGCATGTGGGCTGCCTTTCAAGCTGTC ATGGATGAAACTTTGATCAGGTAATTTACTATAGCTTAACCAGGGTGCTG TACTTTCTACTCTGCCATCTCTAAATCTTTACTGAAGGCAATGGCACCCC ACTCCAGTACTCTTGCCTGGAAAATCCCATGGACGGAGGAGCCTGGTAGG CTGCAGTCCATGGGGTCGCCAGAGTCAGACACAACTGAGCGACTTCCCTT TCACTTTTCACTTTCCTGCATTGGAGAAGGAAATGGCAACCCACTCCAGT GTTCTTGCCTGGAGAATCCCAGGGATGGCGGAGCCCAGTGGGCTGCCGTC TATGGGGTTGCACAGAGTCGGAGACGACTGAAGTGACTTAGCAGCAGCAG CCTATTGCTTGACTGCTTGTGCCAAACCTATGACACATAAGTTTTGTTTG AGCACTCTACTTTCTGGAGTCAAATTCTATATTCCTTAGGATAAATTTTA TTCACAAGTATCTGAGACTGAAATGATAATAGCTTAAACAATACAGAATT TTATTTTAGTCATATAAAAGCCCAGAGGTAGCAATTCAGGGTGGGTATGA TGACTTTATTGCCCCAAATCTTTAGCTTCCAAGCAGTTTGTATTTGCACT TATATGAAAGACCTCCATTCCCAAAGTCATGGGACAACATGGGTATTTCC ATGTTGGGGACAACATGGGTATTCCAGCTCCTGCATTATAATTGAGGTCT AGCAACAAAAGGAGAAGGATGCAAGATGTGGAAAACAGCAAGAAACAAAC AGCACTCTTTCAAGTTTAACGCCTTGAAACTTTCACAGTATACTTTATTG GTCTGATTTAAATCATATTGTTATACATAGCTCCAAGAAAGACTTGCTAA AGAATTATTCTGTGAGAACTACTGCGTAGTCGGTGGT project fbns AG 20040903 6102bp GGGCGATGCAGCAGTAGTTCATCCATTTCATCCGAAAACATGAATTTCAC CTTTTTCTCAAGCGCACATGGAACCTTCTCCAGGATAGATCACATCCTGG GCCATAAAGCTAGCCTTGGTAAATTCAAAAAAATAGAAATCATTCCAAGC ATCTTTTCTGACCACAATGCAGTAAGATTAGATCTCAATCCTAGGAGAAA AACTATTAAAAATTCCAACATATGGAGGCTGAACAACACGCTGCTGAATA ACCAACAAATCACAGAAGAAATCAAAAAAGAAATCAAAATTTGCATAGAA ACGAATGAAAATGAAAACACAACAACCCAAAACCTGTGGGACACGGTAAA AGCAGTCCTAAGGGGAAAGTTCATAGCAATACAGGCACACCTCAAGAAAC AAGAAAAAAGTCAAATAAATAACCTAACTCTACACCTAAAGCAACTAGAA AAGGAAGAAATGAAGAACCCCAGGGTTAGTAGAAGGAAAGAAATCTTAAA AATTAGAGCAGAAATAAATGCAAAAGAAACAAAAGAGACCATAGCAAAAA TCAACAAAACCAAAAGCTGGTTCTTTGAAAGGATAAATAAAATTGACAAA CCATTAGCCAGACTCATCAAGAAACAAAGGGAGAAAAATCAAATCAACAA AATTAGAAACGAAAATGGAGAGATCACAACAGACAACACAGAAATACAAA GGATCATAAGAGACTACTATCAACAATTATATGCCAATAAAATGGACAAC GTGGAAGAAATGGACAAATTCTTAGAAAAGTACAACTTTCCAAAACTGGA CCAGGAAGAAATAGAAAATCTTAACAGACCCATCACAAGCATGGAAATTG AAACTGTAATCAAAAATCTTCCAGCAAACAAAAGCCCTGGTCCAGACGGC TTCACAGCTGAATTCTACCAAAAATTTAGAGAAGAGCTAACACCTATCCT GCTCAAACTCTTCCAGAAAATTGCAGAGGAAGGTAAACTTCCAAACTCAT TCTATGAGGCCACCATCACCCTAATACCAAAACCTGACAAAGATCCCACA AAAAAAGAAAACTACAGGCCAATATCACTGATGAACATAGATGCAAAAAT CCTTAACAAAATTCTAGCAATCAGAATCCAACAACACATTAAAAAGATCA TACACCATGATCAAGTGGGCTTTATCCCAGGATGCAAGGTTTCTTCAATA TCCGCAAATCAATCAATGTAATACACCACATTAACAAATTGAAAAATAAA AACCATATGATTATCTCAATAGATGCAGAGAAAGCCTTTGACAAAATTCA ACATCCATTTATGATAAAAACTCTCCAGAAAGCAGGAATAGAAGGAACAT ACCTCAACATAATAAAAGCTATATATGACAAACCCACAGCAAACATTATC CTCAATGGTGAAAAATTGAAAGCCTTTCCTCTAAAGTCAGGAACAAGACA AGGGTGCCCACTTTCACCATTACTATTCAACATAGTTTTGGAAGTTTTGG CCACAGCAATCAGAGCAGAAAAAGAAATAAAAGGAATCCAAATTGGAAAA GAAGAAGTAAAACTCTCACTATTTGCAGATGACATGATCCTCTACATAGA AAACCCTAAAGAGTCCACCAGAAAATTACTAGAAATAATCAATGACTACA GTAAAGTTGCAGGATATAAAATCAACACACAGAAATCCCTTGCATTCCTA TACACTAATAATGAGAAAACAGAAAGAGAAATTAAGGAAACAATTCCATT CACCATTGCAACGGAAAGAATAAAATACTTAGGAATATATCTACCTAAAG AAACTAAAGACCTATATATAGAAAACTATAAAACACCGGTGAAAGAAATC AAAGAGGACACTAATAGATGGAGAAATATACCATGTTCATGGATTGAAAG AATCAATATAGTGAAAATGAGTATACTACCCAAAGCAATTTATAGATTCA ACGCAATCCCTATCAAGCTACCAACAGTATTCTTCACAGAGCTAGAACAA ATAATTTCACAATTTGTATGGAAATACAAAAACCCTCGAATAGCCAAAGC GATCTTGAGAAAGAAGAATGGAACTGGAGGAATCAACCTACCTGACTTCA GGCTCTACTACAAAGCCACAGTTATCAAGACAGTATGGTACTGGCACAAA GACAGAAATATTGATCAATGGAATAAAATAGAAAGCCCAGAGATAAATCC ACGCACATATGGACACCTTATCTTCGACAAAGGAGGCAAGAATATACAAT GGATTAAAGACAATCTCTTTAACAAGTGGTGCTGGGAAATCTGGTCAACC ACTTGTAAAAGAATGAAACTGGACCACTTTCTAACACCATACACAAAAAT AAACTCAAAATGGATTAAAGATCTAAACGTAAGACCAGAAACTATAAAAC TCCTAGAGGAGAACATAGGCAAAACACTCTCCGACATACATCACAGCAGG ATCCTCTATGACCCACCTCCCAGAATATTGGAAATAAAAGCAAAAATAAA CAAATGGGACCTAATTAAACTTAAAAGCTTCTGCACATCAAAGGAAACTA TTAGCAAGGTGAAAAGACAGCCTTCAGAATGGGAGAAAATAATAGCAAAT GAAGCAACCGACAAACAACTAATCTCAAAAATATACAAGCAACTCCTACA GCTCAACTCCAGAAAAATAAACGACCCAATCAAAAAATGGGCCAAAGAAC TAAATAGACATTTCTCCAAAGAAGACATACAGATGGCTAACAAACACATG AAAAGATGCTCAACATCACTCATTATCAGAGAAATGCAAATCAAAACCAC TATGAGGTACCATTTCACACCAGTCAGAATGGCTGCGATCCAAAAGTCTA CAAATAATAAATGCTGGAGAGGGTGTGGAGAAAAGGGAACCCTCTTACAC TGTTGGTGGGAATGCAAACTAGTACAGCCACTATGGAGAACAGTGTGGAG ATTCCTTAAAGAACTGGAAATAGAACTGCCTTATGATCCAGCAACCCCAC TGCTGGGCATACACACTGAGGAAACCAGAAGGGAAAGAGACATGTGTACC CCAATGTTCATCGCAGCACTGTTTATAATAGCCAAGACATGGAAGCAACC TAGATGCCCATCAGCAGATGAATGGATAAGAAAGCTGTGGTACATATACA CAATGGAGTATTACTCAGCCATTAAAAAGAATACATTTGAATCAGTTCTA ATGAGGTGGATGAAACTGGAGCCTATTATACAGAGTGAAGTAAGCCAGAA GGAAAAACATAAATACAGTATACTAACGCATATATATGGAATTTAGAAAG ATGGTAACAATAACCCTGTGTACGAGACAGCAAAAGAGACACTGATGTAT AGAACAGTCTTATGGACTCTGTGGGAGAGGGAGAGGGTGGGAAGATTTGG GAGAATGGCAATGAAACATGTAAAATATCATGTAGGAAACGAGTTGCCAG TCCAGGTTCGATGCATGATGCTGGATGCTTGGGGCTGGTGCACTGGGACG GCCCAGAGGGATGGTATGGGGAGGGAGGAGGGAGGAGGGTTCGGGATGGG GAACACATGTGTACCTGTGGCAGATTCATTTTGATATTTGGCAAAACTAA TACAATTATGTAAAGTTTAAAAATAAAATAAAATTAGAGAGAGAAAAAAA AAAAAGAATTTTCAAAAAAAAGAAAGAATACATAGAAGAACTATACAAAA AAGATCTTAATAACCCAGATCACCATGATGGTGTGATCTCTCACCTAGAG CCAGACATCTTGGAGTGTGAAGTCAAGTGGGCCATCACTATGAATAAAGC TAGTGCAGGTGATGGAATTCCAGCTGAGCTACTTCATATTCTAAAAGATG ATGCTGTTAAAGTGCTAGACTCAATATGCCAGCAAATTTGGAAAACTCAG CAGTGGTCACAGGAGTGGAAAGACCAGTTTTCATTTCAATCCCAGAAAGG GTAGTGTCAAAGAATGTTTAAATTACCACACGATTGCACTCATTCCACAT GCTAGCAAAGTAATGCTGAAAATTCTCCAAGCTAGGCTTCAGCTGTATGT GAACCAAGAACTCCCAGTTCGAGCTGGACTTAGAAAAGTCAGGGGAACCA GAGATCAAATTGCCAACATCCATTGGGTTATAGAAAAAGCAAGAGAGTTC CAGAAAAACATCTACTGCTGCTTCATTGACTACACTAAAGCCTTTGACTG TGTGGATCACAACAAATTGTGGAAAATTCTTAAAGAGATGAGAATACCAG ATCACCTTACCTGACTCCTATGAAACCTGTATGCAGGTCAAGAAACAACA GTTAGAACTGGACATGAAACAACAACTGGTTCCAAATTGGGAAAGGAGTA CATCAAGGCTGTATATTGTCACCCTGCTTATTTAACTTATATGCAGAGTG CATCAATGTGAAATGCTGGGCTGGAGGAAGCTCAAACTGGAATCAAGATT GCTGGGAGAAATATAAATAACCTCAGATATGCAGATGTTTACTTTCTGTC CTTATGGCAGAAAGTAAAGAGGAACTAAAGAGCCTCTTGATGGAAGGTGA AAGAGGAGAGTGAAAAAGCTGGCTTAAAACTCAACATTCAAAAAATGAAG ATCATGGCATCCGGTCCCAAAACTTCATGGCAAATAGATGGGGAAACAAT GGAAACAGTAACAGATTTTATATTCTTGGGTTCCAGAATCACTGAAGATG GTGACTGTAGCCATGAGATTAAAAGATGCTTGCTTCTTGGAAGAGAAGTT AAGACAAACCTAGACAGTGTATTAAAAAGCAGAGACATCACTTTGCCAAC AAAGGTCCATATAGTCTAACCTATGGTTTTCCCAGTAGTCATGTATGGAT GTGAGAGTTGGACCATAAAGAAGGCTGAGTGCTGAAGAATTGATGCTTTT GAACTGTGGTATTGGAAAAGACTCTTGAGAGTCCTTTTGGACCGCAAGGA GATCAAACCAGTCAATCCTAAAGGAAATTAGCCCTGAATATTCAATGGAA GGACTGATGTTGAAACTGAAGCTCCAATACTTTGGCCACCTGATGCAAAG AGCCAACTCATTAGAAAAGACCCCGAGGCTGGGAAAGATTGAAGGCAGGA GAAGGGGACAACAAAGGATGAGATGGTTGGATGGCATCACCAACTCAACG GACTTGAGTTTGAGCAAGCTCCAGGAGATGACGAAGGACAGGGGAGCCTG GTGTGCTGAAGTCCATGGGGTCGCAAAGAGATGGACACTACTGAGCAACT GAACAACAACAAAAATTAATTTGCAATATGTCCTAAAGTTTTATAGCAGC TGCTGTGATAGTAAAATGAGTAGTGGACTCATGATACTGTCCTTGCTGAT TAGTGGCTGTGAAATCTATTCAAGACATAACTTTTCTCACATGCAAAATG GGGTAAAAATGAGGTCAAATGTAGTTAAATATAATCCAGTAAATACTTTA TGAAAGTTAAAAATCCCTCTATATATGCATAAGAATAAAATTTATGGTAA ATGAATATTTGTGATGTATTGAGTGTCAACAGTTTTGTACATTTTTCCTA ATTATTTTACCATTGCTCTAAAATCTGTTTTCACTTCTTGATTGGGTCTT TTATTTTTCTGGAATTGAGCTGCAGGAGTTGCTTGTATATTTTTAAGGCC AAGGAACTAAACAGACATTTTTCCAAAGAAGACATACAGATGGCTAACAA ACACATGAAAAGATGCTCAACATCACTCATTATCAGAGAAATGCAAATCA AAACCACTATGAGGTACCATTTCATGCCAGTCAGAATGGCTGCGATCCAA AAGTCTACAAGCAATAAATACTGGAGAGGGTGTGGAGAAAAGGGAACCCT CTTACACTGTTGGTGGGAATGCAAACTAGTACAGCCACTATGGAGAACAG TGTGGATTTTCGGATAAAAACTGGAAATTGAGCTTCCATATGACCCAGCA GTGCTACTGCTGGGCATACACACCGAGGAAACCAAAAGGGAAAGAGACAC GTGTACCCCCAATGTTCATCGCAGCACTGTTTATAATAGCCAGGACATGG AAGCAACCCAGATGTCCATCAGCAGATGTGAGAACTACGTACCTCGAGCC CC project fbns AH 20040903 5799bp AGGAAGATCCCCCAAAGAAGGGAATAACAACCCACTCCAGTATTCTTACC TGGAGAATTCTATGGACAGAGGAGCCCGGTGGGTTACAGTCCGTGGAGTT GCAAAGAGTCAGCCTTGACTGAGCAAGTAACACTTTCTATTTTACTTTCC ATTATAATATTACAGTATTCTGTATTTGTCTATATATTTACCTTATCAGT GAGATTTATACTTTAATATGCTTTTATATGTTTATCATCCCTTTGTTTCA ACTTGAAGAACTTCCTTTAGTGCTTCTTGTAAGGCAGTTCTAGTGGAGAT GAATTTTTCCTATTTTCATTTGTCTGGGAAAGTCTTTAACTTTTAAAGGA GAGTTTTGAGATGTATAGTATTATTGGTTAGCAGATTTTTTTCTTTCAGT ACTTTAAACTATGAATGTAAGTCTTCTTGTCCTGCTAAGTTTCTGCTAAA AATACCCCCTGATAGTCCTATGAGAATTCCCTTTTATGTGATGAGTTGAT TTTCTCCTGCTGCTTTCAAAATTCTTTCTTTGACTTTTGACATTTGATTA TAATGTGTCAGTGTAGACTTCTTTGTATTCAACCTGTTTAAAATTTGTTG TGCATCATGAATCTGGATGTCCATTTCCTTCCTCAGATTTAGGTGTTTTC AGCATTTATTTCTTTAAGTAACATTTCTGCCCGTTTTTCTTTCTCTTCTC CTTCTGGGACACCATTGATGTATATATTGATTTGCTTGATGGAGTCTCAT ATGTGCCATAGACTTTTTTCACTGGTTTTCATTTTTTTCTTTTTATTCCT CTGATTGGATAATTTATTTTTTATATAAATTTATTTATTTTAATTGGAGG TTAATTACTTTACAATATTGTATTGGTAGAGCCATACATCAACATGAATC TGCCACAGGTATACATGTGTTCCCCATCCTGAACCCCGGATGATTGGATA ATATAAATTGATTTATATTCAAGTTCACAGATTACTTTTTTCTACTTGGT CAAGTCTGCTGTTGAAGGTCTTTATTTAATTTGCAGTTCATTTCTTGAAT TCTACAGTTCAAAAATATTTGGTTGGTCCTTTTTTACAGTTTCTGTCTCT TTACTGAACTTCTTATTTTGCTCATGTATCCCTTTCCTGATTTTGTTCAG TTATCTGTGTTCTCTTACAGTTCACTGAGTTCCTTTAAGACAATTATTTT GAATTCTTAGAATTATTTTGAATTCTAACAAAGGGTCAGGTACTGGAGTT TTAATTTTGTTCCTTTTTTATTTTTACATTTTACATAATTGTATTAGTTT TGCCAAATATCCAAATGAATCCACCACAGGTATACATGTGTTCCCCATCC TGAACCCTCCTCCATCCTCCCTCCCCATACCATCCCTCTGGGTCGTCCAG GTGCACTAGCCCCAAGCATCCAGTATCGTGCATGGAACCTGGACTGGCAA CTCGTTTCATACATGATATTTTACATGTTTCAATGCCATTCTCCCAAATC TTCCCACCCTCTCCCTCTCCCACAGAGTCCATAAGACTTCTATACATCAG TGTCTCTTTTGCTGTCTCGTACACAGGGTTATTGTTACCATCTTTCTAAA TTCCATATATATGCGTTAGTATACTGTATTGGTGTTTTTCTTTCTGGCTT ACTTAACTCTGTATAATAGGCTCCAGTTTCATCCACCTCATTAGAACCGA TTCAAATGTATTCTTTTTAATGGCTGAGTAATACTCCATTGTGTATATGT TCCACAGCTTTCTTAGCCATTCATCTGCTGATGGACATCTAGGTTGCTTC CATGTCCTGGTTATTATAAACAATGCTGCGATGAACATTGGGGTACACGT GACTCTTTCCCTTCTGGTTTCCTCAGTGTGTATGCCCAGCAGTGGGATTG CTGGATCATAAGGCAGTTCTATTTCCAGTTTTTTAAGGAATCTCCACACT GTTCTCCATAGTGGCTGTACTAGTTTGCATTCCCACCAACAGTGTAAGAG GGTTCCCTTTTCTCCACACCCTCTCCAGCATTTATTATTTGTAGACTTTT GGATCGCAGCCATTCTGACTGGTGTGAAATGGTACCTCATAGTGGTTTTG ATTTGCATTTCTCTGATAATGAGTGATGTTGAGCATCTCTTCATGTGTTT GTTAGCCATCTGTATGTCTTCTCTGGAGAAATGTCTATTTAGTTCTTTGG CCCATTTTTTGATTGGGTCATTTATTTTTCTGGAGTTGAGCTGTAGGAGT TGCTTGTATATTTTTGAGATTAGTTGTTTGTCGGTTGCTTCATTTGCTAT TATTTTCTCCCATTCTGAAGGCTGTCTTTTCACCTTGCTAATAGTTTCCT TTGATGTGCAGAAGCTTTTAAGGTTAATTAGGTCCCATTTGTTTATTTTT GCTTTTATTTCCAATATTCTGGGAGGTGGGTCATAGAGGATCCTGCTGTG ATGTATGTCAGAGAGTGTTTTGCCTATGTTCTCCTCTAGGAGTTTTATAG TTTCTGGTCTTACGTTGAGATCTTTAATCCATTTTGAGTTTATTTTTGTG TATGGTGTTAGAAAGTGGTCTAGTTTCATTCTTTTACAAGTGGTTGACCA GATTTCCCAGCACCACTTGTTAAAGAGATTGTCTTTAATCCATTGCATAT TCTTGCCTCCTTTGTCAAAGATAAGGTGTCCATATGTGCGTGGATTTATC TCTGGGCTTTCTATTTTGTTCCATTGATCTATATTTCTGTCTTTGTGCCA GTACCATACTGTCTTGATGACTGTGGCTTTGTAGTAGAGCCTGAAGTCAG GTAGGTTGATTCCTCCAGTTCCATTCTTCTTTCTCAAGATCGCTTTGGCT ATTCGAGGTTTTTTGTATTTCCATACAAATTGTGAAATTATTTGTTCTAG CTCTGTGAAGAATACTGTTGGTAGCTTGATAAATTTTGTTCTTTTGTTGG TGTTATGTTTGCCTGATTCCTCTTGATCCTTGTAACCTTGCATTAGTGTA TGTACCTTTCAAGGAGGAGTCACTTCTTTGAGTCTTTATAGTCTGGCTTC AGCAAAGAAAGTTCTTTACCAGTTAATTTTGCCTGAGATCTGTGTGGGCT GGTTGGTGGGGACCGTGAGCAGGAGCTGGTGAGGTATGTGTGCCAGCCTT ATGCTGGGGTTCACTAGCAGGCAGGCTTGGTGCCAGGGTTGCACATGGGC TTGCCAAGTCCTAAGGTGTGTAGGTGGGTAGGCCTGATGCCAAGGTTCAC AGGCAGATCTGCTTTAGGGGGTTGCAGGTGGGCCTGGTTTCTGGAACCAT TAATAAGCAGGCTCGGTGCTGGGGTCCATGGCAAGTACACCTGCTGCTGG CATCTGCTAGTGTGTTGTTCTCTCTTTCCCCCATAGAAGAACTCAGACCA AAGGTGGGTTTTTTCCACGCTCTTCTGTGCTGAGTTGTGAAAGGGGTGAC ATAGGTAAAGTAAAACTTTTTTCCTACCCTTTCAATTATGTCTTTTCTCA TTTCTGTGTTCCATCAGTGTGCTATAGTCTCTTACTTGGATTCTAAATCT TTCATAAAGGTATTTTTAATCCATAGACTGTTGCTAAATTAGTGCTTCTC TGGAGAGGATGAAGACAGGGACCTCCCAGCCCACCATCTTGCTAACATCA TTCCTTAATTATATTTTTAAAAGATTGCTCTGAGAATCTCAAAATAACCT GAAAGAAAAAACTTGCTATGAAATCAAACCCCTAGCATTAACTTTTATCA CAGTGTTAATTTCTGTGTAAGGTATTGCCTTGAGGCAAAGTTGAGTTTCT TTCTACAATTCATGGAATCTCTCGATCTAGTTAGTTGAACTGTGTTTGTT GGTAACCAAGAGGAAGAGAAAGCCTTATCCCTGGCTACTGTGAACACTTA CTTGCGTTCCCTTCCAAGTTGCTTTGCTCTGGGTTGATTTCAGAATGAGC ACTGGGAGCCCCCATGCACAATGTTGCTGTACACAGAGTGAAAGAAGAAG AATTTAAGAAATTATCTCCCTTATCCTGAGGCCAAATTACTGTCAACAGA TGTCCAGATATGGTCCACATTTTGTCACTTTACATTATTAGTGTTGAATT TCTATCCTAAGTGTTAACTTTCAATATGATTTCTATTTCTTCCCCACAGC AGTATTCTCAATGTTGACTTCACAAGCTAAACATTTTTATCACTTACTGG ATCTGGTACACACCAGTGTACCACTAACTGAGAATTCAGGTAAGTGGGTA TTGTTCCTCAGGTGGGCGGGGAAACTCAGCTATTTAGTGAACGAATGGAC AAAAGGATAGGTTTCTGAGTCTTCAGAAATGGTGAACTAAGTGAGCTAGT GTTTAATTAGAACATCAAAGGCCAGGATGGGTCTCAAGATTGAGTCCAGA GTATGGAATAGTTACATTGAGACTCAGCTCTTCTGTATATTGACCCCATA TATAGAATATCAAAGGGATACATGCTCAAGTCTTATTTAAAGTGTGAGAA TAGAGTTTAACTAACCATGTGGAACCTTAAAACTTGCCAAAATGACTTAG ATACATGTGGTGACTATATATATTTTTGGATATATTGGTTTTAGGATGAG AATGGTGTATCTATCCAGAGCATTGTTCTGTTACTGGGAAACAGCTTCTC ATGACTCATTGTACTCATAGCATTGCCTACAAAAACCCACCTAAAATATC ACTGGGCATGATAATCTAGGCTACTATTTTTTTTTTAATTTTCTGTAATT GTATTAATATATTTTAAAATTAAATGATAAATGATGCCACTAAGTAAAAC GAGAGATTTAAAACAAGAAAAATCCAAAGCAATATAATTTCATATTCAGT CTCTAAATTCCCTTCTTATCACATTGTCCTCCTACTGTCTAATGGTTTCT TAAACTTCACTTTCACCTATACTTCATGACTGAACAGTTAATTTCATTAT TATCATGTCTTTATAATTTCTTGTGTTCCTATGGGCATGCTCACAGACAT TCACATGTATAACCAATGAATTCATTTATGCTTTATTGAAAACAAATGGA AGCAATCGAATGGAAATTCCCTTAACTTCCTCCACTTATGACCTTCCCTC CCAGATACAGAATAGACAAAGTGCCCCTGCTTCTACCTAAGTCCTTTTCA CCTGGATTTAATGCTCTGTTTCTCAAGTAATTCACTCTTGAAATTTTTCT TCATCCTCCTCTAATGTCAGTAGACTTTCCTTTTCAAATGTATCACTATG AGCCATATAAAAGTACTCTAGTTCAAAAAAAGATTTTATTTAAAAAAATA GTAATTGGCTGATTTAAAACATTTATGATATGATAATGACCAGGAAGTGA GCTTTTAAGTATCTGAATATGGATTGTGGGACAGTAATGAAGAAAACATT TATGCAGAGTAAGATCTAGGTGCTGGGGTAACGGAGAAGCATTAAAGGAC TTTTGATGTGGATATTCTTTTTTTGTTTTCCAGAAAGAACACTTCTCTAT ATGATAATGAAAAACCATAGTGCTATCAATGAGTTCGTTCTCCTTGGGCT ATCTATTGACCCACATATTCAGGCTGTACTCTTTGTGCTGTTCCTTCTGA TTTACCTCCTCACTCTAATGGGAAATTTCTTGATGCTGCTGCTGCTGAGG GCTGATTTTCACCTCCACACACCCATGTACTTCTTTTTGAGACAGCTCTC CTTTCTGGATCTCTGCCATTCATCTGTCACAGTCCCCAAGATGCTGGAAA ATCTACTTTCTGAAAGTAAAACCATCGNTGAGAACTACTACCTGTGCCC project fbns AI 20040903 5639bp GCTTTTCCCCCCCAAAATATTCTCGGGGGGAAAACATAATTTATTTATTT TTTTTTTGGGGAAAAGAGGGAGGGAGAAAAAAATTTGTTTATATTTTTCA AAAAAAAAAAATAACCCCTGCCCCCTTTTCCGGGGTTTTTAAAGGCCGCC CCTTTTTTTCCAATAGGGTTAAGACCACTGGAAAGCAAACCTTAATGGTT CCATTCAGCCAAAATGAAATAGACAAAAAGGAGATTTGGTATACATTAAA CAATTGAATTATGAATCCACTGTTAAAAGAAGAATGACATAAAGGCAATT TGCAGAAACACGGACGCCATTGGAGGGCATGAAAAGTGAACTACATCCGA ACTGTGAAAGACAAATACTATATGGTATCACTGCATGTGAAATTGTAAAA TATATGACCTTTGAACATAACAGAAAAGCAGCAGACTCACAGATATAGAG AACAAAATAGTGTTTACCAATGGAGAGAGAAAAGGGAGAGAGATAACAAT ATACCAGTAGGGGATTAAGAGGTACACACTCTTAGCTAAACAGTCAGCTA CAAAGATATAATGTACAACACAGGGAATATGGAAAATACTTTATAAGTGG AATATAACCTTTAACCAATGTGAATCACTATTATACACATGTAATTTATA TATTATACTTTACATTTCAGTAGAACGTTTACTAAAAGAATAAAATTAAA ATTGAAAAAAAATATTTCAACAATTCATTGTTAGTATGTTAGATATCAAC ATATAGCCCATATTTTATCAAGTTATACCTATCCATGTTTACTTACAAAG TGAAAGTGAACTGGAAGTCACTCAGTTGTGTCTGACTCTTTGCAACCCAA TGGACTATATAGTTCGTGGAATTCTCCAGGCCAAAATACTGGAGTGGGTA GCTATTCCCTTCTCCAGGGTATTTGCTCCATCCTATTACCTTTGCTCCTT TGAAAAGATCAGTTACTATAGACATGAAGGTCCATTTCTGGGCCTTTTGT TCTGTTACACTGATTGATTTCTCTATTCTTTCACCAGTACCACACTGTCT TGATTGCTGTAGCTTTATACTAAGTCTTGTAGTCAGGTAGTGATGGTTCT

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbns.fa (2013-03-31)
    Open archived version from archive


  • AACCCTCCACCCTCTTCCCTCCCAGCACCATCCTGGCCTTTTCTAGTCCT GTGGTCACTGCTGAGTTTTCCAGATATTCTGGCATATTTGGTCTGCATAA CAATATATTCAGTTCAGTTCAGTTCAGTCGCTCAGGCGTGTCTGACTCTT GTGAGCCCATGAATCACAGCAAGCCAGGCCTCCCTGTCCATCACCAACCC CCAGAGTTTACTCAAACTCATGTCTATGGAGTCAGTGATGCCATCCAGCC ATCTCATCCACTGCCATCCCCTTTTCCTCCTGTCCCCAATCCCTCCCAAC ATTAGAGGCTTCTCTAATGAGTCAACTCTTCACATGAGGTAGGTAAAGTA TTGGAGTTTCAACTTCAGCATCAGTTCTTCCAATGAACACCCAGGACTGA TCTCCTTTAGAATGGACTAGTTGGATCTCCTTGCAGTCCAAGGGACTCTC AAGAGTCTTCTCCTACACCACAGTTCAAAAGCATCAATTCTTCATCACTC AGCTTTCTTCACAGTCCAACTCTCATGTCCATACATGACCACTGGAAAAA CCATAGCCTTGACTAGACGGATCTTTGTTGGCAAAGTAATGTCTCTGCTT TTTAATATGCTATCTAGGTTGGTCACAACTTTCCTTCCAAGGAGTAAGCA TCTTTTAATTTCATGGCTGCAATCACCATGTACAGTGATTTTGGAGCCCC CAAAAAACTGTTTACACCGTTTCCCTATCTATTTGCCATGAAGTTGAGCT ATTTCAAATCCTGAAAGATGATGCTCTGAAAGTGTTGCACTCAACATGCC ACCAAATTTGGAAAACACAGCAGTTGCCACATTACTGGAAAAGGTCAGTT TTCATTTCAATTCCAAAGAAAGGCAATGCCAAAGAATGCTCAAACTACTG CACAATTGCACTCATCTCACACGCTAGTAAAGTAATGCTCAAAATTCTCC AAGCCAGGCTTCAGCAATACGTGAACCGTGAACTTCCAGATGTTCAAGCT GGTTTTGGAAAAGGCAGAGGAACCAGAGATCAAATTGCCAACATCCTCTG GATCATCAAAAAAGCAAGAGAGTTCCAGAAAAACATCTTTTTCTGCTTTC TTGACTATGCCAAAGCCTTTGACTGTGTGGATCACAATAGACTGTGGAAA ATTCTGAAAGAGATCAGCATACCAGACCACCTGACCTGCCTCTTGAGAAA CCTATATGCAGGTCAGGAAGCAACAGTTAGAACTGGACATGGAACAACAG ACTGGTTCCAAATAGGAAAAGGAGTACGTCAAGGCTGTGTATTTTCACCC TGCTTATTTAACTTATATGCAGAGTACATCATGAGAAATGCTGGGCTGGA AGAAGCACAAGCTGGAATCAAGATTGCCAGGAGAAATATGAATAACCTCA GATATGCAGATGACACCACCCTTAAGGCAGAAACTGAAGAGGAACTAAAA AGCCTCCTCTTGAAAGTGAAAGAGAAGAGTGAAAAGTTCAGCTAAAGCTC AACATTCAGAAAACTAAGATCATGGCATCTGGTCCCATCACTTCATGGCA AATAGATGGGGAAACAGTGGAAACAGTAATATACTAATACTGTTGATATC ACACTTATGAAAGCTCCTGTCAATAAGATTTGTTAATGTCATAATATGTT TTTTCAATTAACAAGAAAATATAAAAATATGTTAAATTTGATGGAAAGAT TTAGAATATAAGATTTAGACAAAAGAGTTTCAAACAAAGACCTGAGTGTC TTAGAATATTGCTTTTAGACCTCTCCAAAGTTAGCCAACCTGTTTTTCCA TTAATATTATCAGTTTTGCGTGATGCCTGCCTTCTATTTTTAATCACAGT ATTATATTAATTCATATGGCTTATTCTTATACAATTGTGTCCACTGTCAG TCTACCCAAAAGAAGATAATTCTAGTTGATCAACATATAATTAAGAAAAT CAACCTTCTTTTATTGAAATTGCAATTATTTAAACCTAAATCTCAGGATT TTAATTTATTTCTCTGTATAATAAATCCTGGTCTTTCAAAATAAAATTGC CAAGAAAGAGAATAAGAAAGATAGTACAGGAACCAAATGAGTGAAAGTGT TGGAAAACAATGACCAGTGATATCAGTTCAAAAGTGAATAGAGCAACAGC CATTTTTCCTGATGATTAAGTAAAAATAGTGGAGAAGCTGCTATAAAATT TGGCAAGTGTGACTGTACATAAGCCAAGGTATCCAGTTATATAATATTTA AACACTCACATATCATATAGCTAAGCAATTCTGATGCCTTAGGAATAAAC ACCAAACAGAGAAAACCTGGCAAAATACCAGCATATGTCAGTAATAAGTG AACACTTGTATAAAGATTCTAAGAGAGAAATCTCTATCAATTATGGATAC TTTGTTTATAGAATGAATAAAAGAAATCACATTGTTGTTCTATATCATTT CTCAGATAAAATAATACTTGCCAATTTTTTAACATAGTGAGATGCTAGGA TAATTTTAACTGCTTCAGATACATATTACAAGCCCATGATGAAGCAAGTC AAAAATAGCCATTTAGTGATCTAATCTTACTTATGAAGAATACTTAAAAG CTGAAAGTTAAAACTAGTTATATTTTCATTAGACTGTAACATTAAAAATC AAAATATCTGACAACAGTGTTAGTTGGTAGATGATTATTTGCTAGCAGTT CTGCAGGAAAAAATTAGAGCATTCAATGTTCCACTGTGTAATAAGTATAT CTTTCTTGAAAGTTCAGTTGCTCTTTTATTATTCAGTAGCATGCATATGT CAAATTGATTAATTCTTATAATATGGACAATATACTTCCTCAAGGAGACA GTGATTATTCACAGCAATGCATTTTCAAGTCTCTTCAGACTAGTAATGCC TTATTGTAACGATGGACTTCATATTTGCTCTCATGATAGTAATCTTTGCT TATTTTTTGCATTACTGGGATTTGCATTCTGGGTTCAGTCAGTTCAATCA TTGTCATGTCCAATTCTTCACGACCCCATGGACTGCAGTATGCCAGGCTT ACCTGTTCATCACCAACTCCTGGAGCTTACTCAAACTCATGTCCCTCAAG TCAGTGATGCCATCCAACCATCCCATTCTCTGTTGTCACCTTCTCCTTTT GTTTTCAATCTTTCCCAGCATCAAGGTCTTTTCCAATGAGTCAGTTCTTC CCATCAGGTGGCTGAACTATTGGCCTTTCAGCTTCAGCATCAGTCCTTAC AATGGATATTCAGAACTGATTTCCTTTAGGATTGACTGGTTGGATCTCCT TGCAGTCCAAGAGACCCTCAAGAGTCTTCTTCACCATCACAGTTCAAAAG TATAAATTCTTCAGTGATCAGACTTTTTTATGGCCCAACTCTCACATCCT TACATGACTAGTGGAAAACCCATAGCTTTGACTAGATGGACCTTTGTTGG CAAAGTAATGTCTTTGCTTTTTAATATGCTGTCTAGGTTGGTCAAAGCTT TTCTTCCAAGGAAAAAGCGTCTTTTAATTTCATGGTTGCAGTCACCATCT GCAGTCATTTTGGAGCCCCCCAAAATAAAGCCTGTCACTGTTTTCATTGT TTCCCCATCTACTTGCCATGAAGTGATGGGAGCAGATGCCACAATCTTAG TTTTCTGAGTGTTGAGTTTTAAGTCAACTTTTTCACTCTCCTCTTTCACT TTCATCAATAGGCTCTTTAGTTCTTCTTTGCTTTCTGCAAGAAACTGTAA TTTCTTAAAAAGTTGTTTTTGCAAAATGTGCAAATATAAGATCAATCAAA TTTATCAAATCCAGGGAATCTTGAGTTTCATGTTTCTATTAGGGAGGCAC AATTTGTGCCCATGTAAAAAGACATAATCTTAATCAATAAACATTGTGTG TGTTCTTACTGCTCCACTGATAGTCCATTCCCTGTCTCTCTCCATCACCT CAAGCCTCTTTATTCCCTGAAACACAGCGATATTGAAATTAGACCTCATG GATGAGTCACAAGCTGGAATAAAGACTGCTGGGAGAATACCAATAACCTC AGATATGCAGTACTATCCTAATGGTAGAAAGTGAGGAGTAACTAAAGAGC CTCTTGAAGAGGGTAAAGAGAGTGAAAGAACTGGCTTAAAACTCAACATT ACAAATAAATAAATAAACCTAAGATCATGGTATACAGTCCCACCATTTCA TGACAAATAGAAGGGGAAAAAGTGGAAATAGTGAAATATTTTCTTTTCTA AGGCTCCAAATTCACTGTGGATGGAGATTGAAGCCATGAAATTAAAAGAA ACCTGATCCTTGGAAGGAATGCTACAACAATGCTAGACAGCATATTGAAA AGTAGAGACATCACTTTGTGAACCAAAGTCCATGTAGTCAAAGCTATGGT TTTTCCAGTATTCATGTACAGATATGAGAGTTGGACCATAAAGAAAGCTG AGTGCTGAAGAATTGATATTTTCAAATTGTGGTGTTGGAGAAGACTCTTG ACAGTCCCTTGGATAGCAAGGAGATCAAGCCAGTCAGTCCTAAAGTAAGC CAGTGCTGAATATTCATTGGAAAGACTGATTCTGAAGCTAAAGCTCCAAT ACTTTGGCCACCTGATGTAAAGAGCTGACTCACTGGAAAGATCGAAGGAA AAATGAGAAGGGAATGACAGAGGATGAGATGGTTAGATAGCATCATGGAC TCAATGGCCATGACTTTGAGCAAACTCTGGGAGATAGTGAAGGACAGAGG AGTCTTGCCTGCTGCAGTACATGAGCTTACAAAGAGTCAGACATGACTTA CCGACTGAACAACAATAACAAATAATTCTTCAATGGCTTCTAAGTGTTCA AGGGAAAGGAATAGTTGCACATTGCTCAGTTTACATCAAAAGCTAGATTA TGCACAGTGAGGGAGACATTGTTCAAATCAACATAGGCTGAAAGCTAAGC ATCCTGTATCAGTTCACCTATTTGTGAATGGGAAGCAAAAGTTCATGAAG GAAATTAGAAAGCCTAGCCCAGTGAACACAGAAATGGGAAACAGCCCTAC AACAGATGGGGAAGGAAGTTTTAGTGAACTGGAAAAGAGGATCAAACTAG CCATGACTTAACACTGGCCTCAAGCCAAAATCTAAAATAAAAAAAAGGGC CCTAAATCCCTTTTAGTTTTTATGAAGC project fbnt AF 20040903 8942bp CGGGCCCGAGGGTCGTAGTTCTCATAGAGCTGCATTTGAAACAACTATCT ATTTAAGCAATTATTATAATCCATTGTTATTCTCCAAGATCCATGCCTTC CACAGGATCCAAACTTTTAAATTGAATGTGAATGTACTAGGATTCACCAG TCCTGCATCCTTCAATCTATAAATGATAGAACTAAGCTCTGAAGTCCCTC TAGGACTGCAATAATGCTTGTGGCTTATCCTTTTTTAGGTACAGGTAGTT CTAGTGATTTTTGTTTGACCTTTTCCAATGTAATAGACTTCACAAGTCAG GGAGCTAGTGTGGGCATCTGCCAGTTACTTAGGACGTCTCTTCTAATTAT GCATTCCAGAAGTGAGGACATTAGGAATCCTTAGGGTCTATACCAAATTT ATAAAATATGTAATCTACTTTCATTGCCTCCAATGAAAGTTAACTATTGC TTTATAATAAAACACTGTTAAAAATTTTGTGTATAACACCCCCCCCCGAC TTATTGCTACTATCTAAAATAGATAAAAGCTCACAATATAACCTATTTCA GGCAAGCCATTTTAATTAACTGAGATTTGTTTTAGGGATATGTTTCTCAA AGCCTTTTGAAAAGTCAGCTCTTAGTGCTTGGAGAATAGAATTGGTTGGT TTTCCTAGCCCAGAAAAGCTCCTAATTCCCAAATTATCTCAGTTTCCTTT CATTTCTTTTTGCAAACAAGCATCATGAAGTCTGAATTCACATCTTCCTG ATTAACACTTTGCCAAATGGTTGGATGGCATCACCAACTCAATGGACATG GGTTTGGGTAGACTCAGGGAGTTGGTGATGGACAGGGAGGCCTGGCGTGC TGTGGTTCATGGGGTCACAAAGAATTGGACATGACTGAGCGATTGAACTG AACTGAAAATGAAGTTAAAATTATATAACATAAAATATCAGTATCTAATT TTATGTCTTCTTCTTGCATAATTACAAGAAGTGTAATTATATGCCTTCAA GTGCACATACAAGTCTATGTGCCTTCTTAGGCACATAGATTCCTTTTCTG GTTGACTTAGATCATAACCTAGAAAAAATTACAACCGAATACCATGGTTG TCCATCTAGCAGGCTTTTGATATCAGTTTCCTCCACATACTCCATTAATC TATGTAGGCAAAAGCACATACTTTAGTTTTTTTTTTTTATATTAGCACAT TTCCCCTGTAGATATTTAAAGATAGGAGTTCTGGGAATGCTCAATTACAA TTAACCTCAACTACCTCAAACAGGAAGTGAGATACACATTCCTACTTATG AAAAGTGAATCATAACCAAGGGACACTTGAAAATATTCTCTTTCTGCATG ACAACGAAGAGGAGTCATTGTGGGAAACATATTGTCTTTATCTAATATGC ATGTGTTCTAAGTTGCTTTAGTCGTGTCTGACTCTTCATGAACCCATGGA CTGTAGCCCGCCAGGCTTCTTTGTCCATGAGATTTTCCAGGCAAGAATAC TGGGGTTACCATTAAGTGGGTTACCATTTCCTACTCCAGGGGATCTTCCT GATCCAGGGATTGAATCAACATCTCTTATGTCTACTGCATTGATAGGCAG GTTCTTTACCACCAGTGACACCTGGGAATCCCTTATCTAATATATATGGA ATAATTATATATCTAACATATAACTATCCAATATATAATTCCATTTTTAT CCCTCTTATAAACTGTATTCTAACTTCATATCCTCAAAAGAACTTATTAT ATTTACAATTTTGTGCTATTTTTATTTTATATCCATTATAGCTTTTTGTT TTCAGAATTGTCCTATTATAGAAATTCATCTATTTGTATAAAAGAAAAAT AGTCCATATAGAAAAACTGTCCAAATTCACCAAAATATGTATAATAAAAA CTATCTGACTCAGAAATAAATGCTCTGTGTATTATATGATACTACTTTAA ATTTACCCAAGTCTATGTCTTCAACCCTAATATTGACAGAGTATCAATTT ACAAAATGAGCTTCATATGTTTTTTGAGCTCTATAACCACGTTTAAACTA CCTCACCACCCTTTTTGATTTCCATAATTATCTCTATGTCACTATGTCTC CAACCCAAATTCACTGTTTTTTAAAAAATCATTTCCCAAAGAACATCTCT TTTGAAATGACCTAAATCACACAAGCTAGGAATCCTAGATGTGTTTTGGG AGCCTGGACAGAGTGAATAATACTATGAGCACACCAGACTTACAGAAAAT TTCCTCCTGGATTAAACAAGAATTATGCCTCTGACATGCAGTCCCATCAA AGGACAAACACACGTGCCTGAGATACCAGACTAGAGAAAACAGGTACAAA ACAAAAGACTCAAAGCAGAGCTAGAATGTGCCCCCTGCACTGGAGTTTAG CAGCTTTAGAACTGCAGATAAACATTTGGACTGGTTGTGAGGTGAAACTC TACAGGGCTGACCCAGATGTTGATTCCCATGTTTTAGTTAATGGCACTGA CATATTTTGATTACTCACAGTTTTACTCTTGAAACTAACTTAGAGCCCTA GATCATTTTGTTTTTCTGAAAATCATTATCATTTCCTGTGAACTGAAAAG TTTTTGTTATATTGCTCAATACACTCCTATAACCTTATTATCATGCTTTA ACCTACTCCTATCACCTTATTCCAAACACTTAGCTGTTTTTACTTGGCTC CTTGCCTCTTAGCTTCTTCTCAACTTATCTGTACAATCATTGTTGATTTT CTGTCCAATAGCCTTTCCTGTTCCTATGTTTTCCTCCCTAGCAAACATGT CTTCATATCTTATAAGCTTAAAATCCAAGAAACATGTTTGCTCAGAATTA TAAAGAAAGCAGAATTTGTACCCCAATCCTTCTTAATGAAAGAGAGGAGA GAAGCAGGAATTCCTAGAAAATTTCCCTCCCTTAAACACACACACACACA CACACACACACGCACACAAAGGCACACAGACCAAAGCACAATTTTCTTCT CCATTGGCAGTAACTGACTGTGTTTGCATGAGATACCTGGGGCCGCTAAA TAGGCTGACTATAAGAACAATCTGCTACCACAACAAGGATGACAGAAAAA AATAAGAAAAACTCTTACATCTTTGGTAATGTTGAACGGCTGAACCAAAC TTGGAAGTTTTAGCTATCCTTGGGTTTCCCAGGCAGCTCAGTAGTAAAGA ATCCACCTTTGATCCCTGGGTCACAGAGATCCCCTGGAGAAGGAAATGGC AACCCACTCCAGTACTCTTGTCTGGGAAACCCCATGGACAGAGAAGCCTG GAAGGCTATAGCCCAGTGGGTCACAAAAATGTCAGACATGACTCAAGGAC AATATATTACCTGCCTCCTGAGAAATCTGCTGCAGGTCAAGAAGCAACAG CTGGAACTGAAACAACAGACTGGTTCCACATTGGGAAAAAAAGTATGTCA AGAGTTTATATTGTCACCCTGCTTATTTAACTTATATGCAGAATACATCA TGAGAAATTCCCAGCTGCATGAAGCACAAGCTGGAATCAAGATTGTTGGT AGAAATATCAATAACCTCAGATATACAGACAACACCACCCTTATGGCAGA AAGCAAAGAGGAATTAAAGAACTTATTGATGAAAGTGAAAGAGGAGAGTG AAAAAGCTGGCTTAAAATTTAACATTCAAAAACCAAAGATCATGGCATTT GGCCCCATAACTTCATGACAAATAGACAGAGAAACAATGGAAACAGTGAG AGACTATTTTCTTGGGCTCCAAAATCACTGCAGATGGTGACTGCAGCCAT GAAATTAAAAGATGCTTGCTCCTTGGAAGAAAAGCTATAACCAACCTAGA CATCATATTAAAAAGCAGATGCACAAAGCAGTGGAGAGATTTTGAGAATA TACATGCAACATAATTCTGGAATCCTTCCAAATTGGACAGACTTGAGCCT CCAAGTTATAATCACAGACTTATAGAAAATCAAAATATCACACCCAAGTT GCACTGTGGCCTACATGAGAGTTCTGATATTATATTTTTTGTCTCATCAA ATCTCTGTATCCACAGGAACAAGTTAAGTCCTTTGTATGTTACATATACA TGACAAGGGGCTCCCCTGATAGCTCAGTTGGTAAAGAGTCCACCTGCAAT GCAGGAGACCCCAGTTCGATTCCTGGGTCAGGAAGCTCCATTGGAGAAGG AATAGGCTACCCATTCCAGTATGCTTGGGCTTCCTTTGTGGCTCAGCTGG TAAAGAATCCGCCTGCAATGTGGGAGACCTGGGTTCAATCCCTGGGTTAT GAAGATCCCCTGGAGAAGGGAACGGCTACCCATTCCAGTATTCTGGCTTG GAGAATTCCATTGACTGTATAGTCCAGGGGTCGTGAAGAGTCGGACATGA CTGAGTGATTTTCACTTTCACTTTTCATACACAAGTGTTTGAGGAACTAC AAATTGAATAGAACTCTTGACATAATGTCAACTGTTTTTGGCAGCATTAG AGCATATTGGCTTTTTTAAACTATACCACGTTGTCTTGTATATGAATGTC TATTGCAGTGTACCCCCAACCACAATGAGAATTGTTATTACTTTTGAGTC TGTTCTTTTTAAAATGAAATATTATTTTTTCAGAAAAAAAAAATAAAAAG CAGATGCATTACTTTGCTGACAAATGTCCATCCAGTCAAAGCTACTGGTT TTTCCAGTAGTCATGTATGAATGTTAGAGTTGGACTATAAAGAAACCTGA CCGCAGAAGAATTGATGCTTTTGAACTGTGGTGCTGGAGAAGATTCCTGA TATTCCCTTGGACAGCAAGGATATCAACCCAATCAATCTTGAAGGAAATC AGTCCTGAATATTCACTGGAAGGACTGATGCTGAACCCGAAGCTCCAGTA CTTTGGCCACCTGGTGCAAAGAACTGACTCAGTGGAAAAGACCCTTATGT TGGGAAAGATTGAAGGCAGGAGGAGAAGGGGATGACAGAGAATGAGATGG TTGAATGGGATCACTGACTTGATGGACATGAGTTTGAGCAAGCTCTGGGA GTTGATGATGGACAGGGAAGCCTGGCATTCTGCAGTCCATGGGGTCACAA AGCGGCGGGCTTAACTGAGTGATTGAACTGAACTGAGTGGTTGGATGTTC TGTTCCTTGCAACAGGAAGTGTCATAAACGATGAACTTCCCAGTCTTTTG CATTTTTCTCCTTTTCAAGTCAGACCCATCATTGCTGTTCAGATGTGATA CATATGTTAGCTTTGTTCTTGTTCTCTTGCCACATACTCCTGAGAGGTCA GGCCTAACCACACAGTCAAGTAACCAAAATCATTTCCATGCTCTAAGACT CAAGCTGGAGATATTAGCAAGCTAATCAGATAAACCATTCCAGCTCTAAA ATTGCGTACACTCTGAACACTGAGCCCAAGACACCTACCTATAAGTATTG GTAGAAAGTAGTTTTGGTTTTCCACAGACGTGAGTTATTGAAATCCATCT TTTACTGAGCAATTATGTGATCTTAAGAAACTTATTGAATTTCTCTTACT TTCATTTTAAAATGGACATAATGATACTTTTTTGCTGAATTCTTGTGAAG ACTAAACCCCAGTCCTTCCCTTTCAAACTCTGCAATTTTAAGAAAGTCCT GCTTAAGTTTCCATGTATATAAAATGTGAGTAGTAATGTTTACCTCATAG ATTTTTGTTAAGTATTAAATAGGGTAATAAAAGAAGTCTAACACTTAGAA TGCTGTTTGCTACATAGACAACATTATCTACTTGTTGTTGTTGTTCTTAG TAGTTCATTGCCTGACACTGACATATGTTTTTGATAAACACCAACTACTG TTTTTATTATAATAGTTTTTATATATTTATTAATACTTTCACTTTTTACT TATCTAGAAAACACCTCTAACATGGCATGTGCCATATAGATCCTAGCACT ATGCCCTTAAATAGATCTCAGCAGATATTTTGAAATTATGCTAATTCTTC AAACAATACCTAACACAAAGGGCAAAACAATTCTAAGAATAAATCTTTAA GTATTTTTGCCCCAGATATTAAGAAAACTGAAAGCTGTCACTGAAGTACT TGTAAAAATGACAAAAGAATTGAATCAATATAATTGTCCATTTATAAAGG GTTGATTAAATAAATAATGCTACATTCAGTCAGAAAAAATCAATTATTAA ATAGAAGTGTGTCTCTTCATTGCAGGTGGATTCTTTACTATATGAGCCAC AAGGAAAGCCCTGTTTTAAAATATAGAATTTTATTATCAATCATATATGG CAGGACTAACAAATCAAGAGATGATTGCCTTTTAAAAAATAGCTCAGTAT AGTCACAGATTCTAAAAGGAGGAGCACGGGGAGGGGGCCAACAGGAAAGA CCAGAGTTAGTCAAAGGGAGAGAGTGAGGAGAAAGCGAGGGCATGAGTCT TTATTGCAGTTTATTAGGGAAAGATGGATAAGGTGGGGTAAGGAGGCTTA GGATAGGCTAGTTTTAACAATTTCCACAGATTCTGAGTTATAAGATCTGT CTCCAGTTGCTTGATACTTGGTCTTAAGATGATTAGGGCAAAGGAATAGT GTGTGAGCTCCATAAAGGAAATGGTAGGGGGTATGAATTCTGAACTGGTT GGTTTGTGTATGAAAAACATGCTTGAGACAAATTGTTTACTAAGCTATGC TTAAGGATTTATTAACTCTGGAAAGACCAATGTCTCTAGTCAGTTAGGCC CTAAGATGTCAAAGCATCAAACGCAGAAAATAAAATATATGGTATCATAA AGACGTATATTCTTTGCAGCCAAAGATGGAGAAGCTCTATAAAGTCAGCA AAAACAAGACCAGGAGCTGACTGTGGCTCAGATCATGAACTGCTTATTGT CAGATTCAGACTTAAATTGAAGAAAGTAAGGAAAACCACCAGACCATTAA GGTATGACCTAAATCAAATCCCTTATGATTATACAGTGGAAGTGAGAAAT AGATTTAAAGGCCTATATCTGATAGATAGAGTGCCTGATGAACTATGGAA TGAGGTTCGTGACATTGTACAGGACACAGGGATCAAGACCATTCCCATGG AAAAGAAATGCAAAAAAGCAATATGGCTGTCTGGGGAGGCCTTACAAATA GCTGTGAAAAGAGAGAAGCAAAAAGCAAAGGAGAAAAGGAAAGATATAAG CATCTGAATGCAGAGTTCCAAAGAATAGCAAGAAGAGATAAGAAAGCCTT CTTCAGTGATTCAATGCAAACAAATAGAGGAAAACAACAGAATGGGAAAG ACTAGAGATCTCTTCAAGAAAATTAGAGATACCAAGGGAACATTTCATGG AAAGATGGGCTTGATAAAGGACAGAAATGGTATGGACCTAACAGAAGCAG AAGATATCAAGAAGAGGTGGCAAGAATACACAGAACTGTACAAAAAAGAT CTTCACGACCCAGATAATCACGATGGTGTGATCACTCACCTAGAGCCAGA CATCCTGGAATTTGAAGTCAAGTGGGCCTTAGGAAGCATCACTATGAACA AAGCTAGTGGAGGTGATGGAATTCCGGTTGAGCTGTTTCAAATCTTAAAA GATGATGCTGGGAAAGTGCTGCACTCAATATGCCAGCAAATTTGGAAAAC TCAGCAGTGGCCACAGGACTGGAAAAGGTCAGTTTTCATTCCAATCCTGA AGAAAGGCAATGCCAAAGAATGTTCAAACTACCGCACAATTGCACTCATC CCACAGGCTAGTAAAATAATGCTCAAAATTCTCCAAGCCAGGCTTCAGCA ATACGTCAACCGTGAACTTTCTGATGTTCAAGCTGGTTTTAGAAAAGGAA GAGGAACCAGAAATCAAATTGACAACATCCACTGGATCATTGAAAAAGCA AGAGAGTTCCAGAGAAGCATCTATTTCTGCTTTATTGACTATGCCAAAGC CTTTGACTGTGTGGATCACAATAAACTGTGGAAAATTCTGAAAGAGATGG GAATACCAGACCACCTGATCTGCGTCTTGAGAAATTTGTATGCAGGTTAG GAAGCAACAGTTAGAACTGGTCATGGAACAACAGACTGGTTCCAAATAGG AAAAGGAGTATGTCAAGGCTGTATATTGTCACCTTGTTTATTTAACTTAT ATGCAGAGTACATCATGAGAAATGCTGGACTGGAAGAAACACAAGCTGGA ATAAAGATTGCCAGGAGAAATATCAATAACCTCAGATATGTAGATGACAC CACTCTTATGACAGAAAGTGAAGAGGAACTAAAAAGCCTCTTGATGAAAG TGAAAGAGGAGAGTGAAAAAGTTGGCTTAAAGCTCAACATTCAGAAAACA AAGATCATGGCATTCGGTCCAATCACTTTATGATAAATAGATGGGGAAAC AATGGAAACAGTGTCAGACTTTATTTTTTGGGGCTCCAAAATCACTGCAG ATGGTGACTGCAGCCATGAAATTATAAGACGCTTACTCCTTGGAAGAAAA GTTATGACCAACCTAGATAGCATATTGAAAAGCAAAGATATTACTTTGCC AACAAAGGTTCGTCTAGTCAAGGCTATGGCTTTTCCTATGATCATGTATG GATGTGAGAGTTGGACTGTGAAGAAAGCTGAGCACCAAAGAATTGATGCT TTTGAACTGTGGTGTTGGAGAAGACTCTTGAGAGTCCCTTGGACTGTAAG GAGATCCAACCAGTCCGTTCTAAAGGAGATCAGCCCTGGGATTTCTTTGG AAGGAATGATGCTAAAGCTGAAACTCCAGTACTTTGGTCACCTCATGCGA AGAGTTGACTCATTGGAAAACACTCTGATGCTGGGAGGGATTGGGGGCAG AAGGATAAGGGGACGACAGACGATGAGATGACTGGATGGCATCACTACCT CAATGGGTGCGAGTCTGGGTGAACTCCAGGAGTTGGGCGATG project fbnt AG 20040903 8578bp GCGCTGATGACGCAGTAGTTCTCATTATTAAATATACATTTTACATTTAT CTATTTAGGCAATTACTTAAAACCTTCTTTTATTGAAAGTGTGATAAAAA ATTTTGCCTCTGACCTTTAACCAATTGTTTTTATAATACAATTGGTATTT TTATTTTTTTATTTTTTTTCTATTTCATGAATTTCTTTTCTTTTCTTTTT TTTAACTTTTCCAGGTTCTTTTTTTTTTTTTTTTTTTTTTAATTTACAAT ATTGTATTAGTTTTGCCAAATATCAAAATGAATCCGCCACAGGTATACCT GTGTTCCCCATCCTGAACCCTGCTCCCTCCTCCCTCCCCATACCCTCCCT CTGGGTCATCCCATTGCACCAGCCCCAAGTATCCAGTATCGTGCATCGAA CCTGGACTGGCGACTCGTTTCATACATGATACTATACATGTTTCAATGCC ATTCTCCCAAATCTCCCCACCCTCTCCCTCTCCCACAGAGTCCATAAGAC TGATCTATACATCAGTGTCTCTTTTGCTGTCTCGTACACAGGGTTATTGT TACCATCTTTCTAAATTCCATATTTATGCATTAGTATACTGTATTGGTGT TTTTCTTTCTGGCTTACTTCACTCTGTATAATAGGTTCCAGTTTCATCCA TCTCATTAGAACTGATTCAAATTTAATCTTTTTAATGGCTGAGTAATACT CCATTTTGTATATGTACCACTGCTTTCTTATCCATTCATCGGCTGATGGG CATCTAGGTTGCTTCCATGTCCTGGCTATTATAAACAGTGCTGCGATGAA CATTGGGGTACACGTGTCTCTTTCCCTTCTGGTTTCCTCAGTTTGGTTGT GCTGAGTCTTCGTTGCAGCATGCAGCGACTTCTCTCTAGCAATGGCATGA GGGCTTCTTGTGATGTGGGCTTCTGTTGTGCAGCATAGGCTCTAGAGCAT TTGGGCTTCAGTAGTTGTGGCACATATGCTCCGTAGTTGTGGCACATGGG CTTAATTGCCCTGGAGCATGTGGGATCCTGGTTACACAGCCAAGGATCAA ACCCACATCACTTGAATTGCAAGGCAGATTTTTAACCACTGGACCACCAA CCACCAGGGAAGCCTCATAGTTGGAATTTTATATATGAAGAATACCATGA GATATTTAACTTATGACCTTGTTTGATTACATAATATTCATAAAACATTA AGCTAAAATATTTAAAGTTTTTCCTGGTGGCTCAGTGGTAAAGAAGCTGC TTACCACTGCAGGTGAAGCAGGTTTGATCATAGGCTCAGGAGGATTCTCT GAAGAAGGATGTGGCAACCCACTCCGGTATTCTTGCCTGGGAAATCCCAT GGACAGAGGAGCCTGGCAGGCTACAGTCCATAGGATCACGAAAGATTCAG ACACTTAAAGACCAAACAACAACAAAAAAACTACTTACATCTTTTACCTT ATGTGCATTTGTGTCTGGCTGTTGGCAACCCTGTGGACTGTAGCTCACCA GGCAACTCTGTCCATGGAATTTTCCAAGCAAGAATACTGGAGTGAGTTGC CATTTCCCTTTCCAAGGGCTTTTCCTGGTCAAGGAAACTGTGCCTTCTGT GTTTCCTGCATTGGCAGGCAGATTCTTCCACCTGTAAGACTTTTTATTTT TCATACTGTTCATGGGGTTCTCAAGGTAAGAATATTCCCAGGTCGGTAGG TGCTCAATATGCTAATGGAGATCAGTGGAGAAATAACTCCAGAAAGAATG AAGGGATGGAGCCAAAGCAACAACAGCACCCAGTAGTGGATGGGACCGGT GATGGAAGCAAGGTCCAATGCTGTAAAGAGCAATATTGCATAGGGACTTG GAATATTAGGTCCATGAATCAAGGCAAATTGAAAACTGTCAAGTAGAAGC TGGCAAGTGTGAAAGTCAACATTCTAGGAATCAGCGAACGAAAATGGACT GGAATGGGTGAATTTAACTCAGATGACCATTGTATCTACTGCTGTGGGCA AGAATCCCTTAGAAGAAATAGAGTATCCATCATAGTAAAAAGAGTCCAAA ATGTAGTACTTGGATGCAATATTCAAACTGACAGAATGATATCTGTTCAT TTCCAAAGCAAACCATTTAATATCACAGGAATCCAAGTCTACGCCCTGAG CAGCAATGCTGAAGAAGCTGAAGGTGAATGGTTCTATGAAGACCTACAAG ATCTTTTAAAACTAACACCTAAGAAAGATGTCCTTTTCATTATAGGGTAC TGGAAAGCAAAAATAGGAAGCCAAGAAACACCTAGACTAACAGGCAAATT TGGCCTTGGAGTACAGAATGAAGCAGGGCAAAGACTAATAGACTTTTGCC AAGAGAATGCACTGGTCATAGCAAACACCCTCTTCCAAAAACACAAGAAA AGACTCTACACATGGACATCACCAGATGGCCAACACCAAAATCAGATTGA TTATATTCTTTGCAGCCAAAGATGAAGAAGCTCTATATAGTTTGCAAAAA ACCAGACCAGGAGCTTACTGTGGCTCAGATTATGAACTCATTATTGCCAA AATCAGACTTAAATTGAAGAAAGTGGGGAAGATCACTAGACCATTCAGGT ATAACCTAAATCAAATCCCTTATGATTAATGGACAGAGGTTCATGACACT GTACAGGAGACAGGGAGTAAGACCATACCCAAGAAAAAGAAATGCAAAAA AGCAAAATGGCTGTCTGAAGAGGCCTTACAAATAGCTGTGCAAAGAAGAG AAGTGAAAGTAAAGGAGAAAAGGGAAGATATACTCATTTGAACGCAGAGT TCCAGAGAATAGGAAGGAGAGATAAGAAACCCTTTCTCAGTGATCAATGC AAAGAAATAGAGGAAAACAATATAATGGGAAAGACTAGAGATTTCTTCAA GAAAATTAGAGATACCAAGGGAACATTTCATGCAAAGATGGGTTCAATAA AGGACAGAAATTGTATGGACCTAACAGAAGCAGACGATATTAAGAAGAGG TGGCAAGAATACACAGGAGAACTGTACAAAAAAAAGATTTTCATGACCCA GATAATCACGATGGTGTGATCACTGACCTAGAGCCAGACATCCTGGAATG TGAAGTCAAATGGGTTTTAGGAAGCACCACTAAGAACAAAGCTAGTGGAG GTGATGGAATTCCAGTTGAGCTATTTTAAATCCTAAAAGATAATGCTGTG CAAGTGCTGCACGGAATATGTCAGCAAATTTGGAAAACTCAGCAGGTGCC ACAGGACTGGAAGAGTCAGTTTTCATTCCATACCAAAGGAAAGAAATGCC AAAGAATCCTCAAACTACTGCACAGTTGCACTCATCTCACACACTAGTAA AATAATGCTCAAAATTCTCCAAGGAGTAAGCATCTTTTCATTTCATGAAC TTCTAGATGTTCAAGCTGGTTTTAGAAAAGTCAGAGGAACCAGAGATAGA ATTGCCAACATCTGCTGGATCATTGAAAAAGCAAGAGAGTTCCAGAAAAG CATCTATTTCTGCTTTATTGATTATGCCAAAGCTTTTGACTGTGTGGATC ACAATAAACTGTGGAAAATTCTGAAAGAGATGGGAATACCAGACCACCTG ACCTGCCTCTTGAGAAACCTGTATGCAGGTCAGGAAGCAACAGTTAGAAC TGGATATGGAACAACAGACTGGTTCCAAATCAGGAAAGGAGTATGTCAAG GCTGTATATTGTCACCCTGCTTATTTAACTTATACTCAGAGTACATCATG AGAAATGCTGGGCTGGAAAAAGCACAAGCTGGAATCAAGATTGCTGAGAG AAATATCAATAACCTCAGATATGCAGATGGCACCACCCTTATGGCAGAAA GTGAAGAAGAACTAAAGAGCCTCTTAATGAATGTGAAAGAGGAGAGTGAA AAAGTTGGCTTAAAACTCAACATTCAGAAAACTAAGATCATGGCATCCGG TCCCATCACTTCATGGGAAATAGATGGGAAAACAGTGGAAACAGTGTCAG ACTTTATTTTGGGGGGGCTCCAAAATCACTGCCAATGGTGACTGCAGCCA TGAAATGAAAAGATGCTTACTCCTTGGAAGGAAAGTTATGACCAACCTAG ATAGCATATTAAGAAGCAGAGACATTATTTTGTTACCAAAGTTCCATCTA GTCAAGGCTATAGTTTTTCCAGTGGTCATGTATTTATGCGAGAGTTAGAC TATAAAGAAAGCTAAGCACCTGAGATTTGGTGCTTTTGAACTGTGGTGTT GGAGAAGACTCATAAGAGAGTCCCTTGGACTGAAAGGAGATCCAACCAGT CCATTCTGAAGGAGATCAGTCCTGGGTAGTCATTAGAAGGTCTGATGTTG AAACTGAAACTCTAATGTTTTGGCCACCTGATGTGAAGAGCTAACTCATT TGAAAAGACTCTGATGCTGGGAAGGATTGAGGGCAGGAGGAGTAGGCAAC AAGAGAGGACAAGATGATTGGAAGGCATCACTGACTCAATGGTCATGAGT TTGGGTAAACTCTGGGCGTAGTGATGGACAGGGAGGCCTGGAGTGCTGCA GTTCATGGGGCCACAAACAGTTGGACTCGACTGAGTGACTGAACTGAGCT AAAGTCCTTTTAACTTATAGATCCTTATAACAATATCATGTGATATATAT AATTATTAATAACAATTTTCAGATGAGGAGACAGAAGCTTAGAGTGTTTA AATATATTCCAAATACTGCACAGCTGTTTGCTGGAAATAGAAGTGATTTT CCTAATTGCTGAGCAGCATATCTCAGCCAATTTGCTTTGTAGATTTGTTT TAATATTCTTTATAACTGGAAGGAAATTGTGTTCTTTTTTCTGGAATATT CTTGCTTATATTTGTTACCTTAGTTCCATTAATTGTGCACTTTACATAAA TAAGGGACTTCTCTGTAGCTCATACTGTTAAGAGTCTGCCTATAATGCCA GATGCCTGGGTTGAATCCCTAGTCAGGAAGATCCTCTGGTGAACTGAATG GCAGCCCACTTCAGTATTCTTGCTTGGCAATCCCATGGACAGGGGAATCT GTTGGGCTGCAATCCGTGGGGTCACAAAGAGTCAGACACAACTGAGCAAC TAACACAGACAAATCTTTTTCAGTGAACTGATTATTCTTTTCTTGAAAGA AGCAGATATTTCATGTCTCTAACCTAGGTTTATTGAATTTTGCTCATGTT AACTTTCAAAGAAAGTATGAGCAAACACACACACCATCATGATATGAATG TTGAGCTTCCCTTGTGGCTCAGCTGGTAAAGAATCCACCTGCAATGTGGG AGACCTGGGTTCCATCCCTGGGTTGGGAAGATCCCCTGGAGAGGGGAAAG GCTACCCACTCCAGTTTTCCAGCCTGGAGAATTCCATGGACTCTATAGTC CATGGGGTCACAAAGAGTTGGACATGACTGAATGACTTTCACTTCACCTC ACTTCATGAGCAAACACACAAACACACCATCATGATATGAACTTTTTAGC CATATTAGATGAGGTGCTCACATTGCAAATTATTTTTGAAGAGATAAGGA TTAAATGTGGGATGTCACTTAATAGCCTATTCTCATCTCCTCAGCCTTCT CTGGGAAAAAACAGATAGACTAATGATGAAATGGAGCAGGACCGATAGGG TCTTCCCAGGACACCCCCACCCATGTCCTCTGCTTACATCTTCTCTGTGG AAAAAAAAAAAAAAAACTCAGTTAAGGAATACATTTAATCAGAGAAGTGA AAAAGAGCAGGGACAAATAAAAAGCAGTCAAATAGGAGAAAATAATAATT AAAGTGAAAAAATCAGTGTTAATTGCTCAGTCTGTCTGACTCTTTGTGAC CTCATGCACTGTAGGCCACCAGGCTCCTCTCTTCATGGAATTCTCCAGGC AAGAATACTGGAGTGGGTTGTCATTCCCTTCTCCAGGGGATCCTCCTGAC CCAGGGATTGAACCCAGTTCACCTGCATTGCAGGCAGATTCTTTACTGAC TGAGCCATCTGGGAACCTCCAAAATAGTTTAATCATTAAATAAAATCAAG GAAATTTAGTTCCTCCTCATGGACTGTAGATAATATTCTGAGCCATATCC TTTGAGCTGTTGTTTAGATACTAAAACCCCCACCAGGTAGAGAGGTCAAC TATAATACATGATGATTATATACAACTATAATACATTGTAGCCATATAAT ACAACTATAACACATTGTAGCCATAACATAAGTAAGTAAGTCAAAGTCAC TCAGTCGTGTCTGACTTTTTATGACCCCATGGACTATAGAGTCCATGGAA TTCTTCAGGCCAGAATACTGAGGTGGGCAGCCTTTCCCTTCTACAGGGGA TCTTCCCAACTCAGGGACTGAATCCAGGTCTCCTGAAATGCAGGTGGATT CTTCACAAGCTGAGCCACAAAGGAAGCCCAAGAATACTGGAGTAGGTAGC CTATCCCTTCTCCAGCGGATCTTTCTGATCCAGGAATCAAACTGGGGTCT CGTGCATTGCAGCTATAACATAAACTGCCATTGCTATTGCTAAGTCACTT CAGTCGTGTCTGACTCTGTGTGACCTTGTAGACAGCAGCCCACTAGGCTT CCCCATCCCTAGGATTCTCCAGGCAAGAACACTGGAGTGGGTTGCCATTT CCTTCTCCAATGCATGAAAGTGAAAAGCAAAAGTGAAGTCGTTCAGTCAC TTCCGACCTTCAGAGACCCCATGGACTGCAGCCTTCCAGGCTCCTCCATC CATGGGATTTTCCAGGCAAGAGTACTGGAGTGGGGTGCCATTGCCTTCTC CAAACATAAACTGCCATAAGTCTTCTGAAATATTCCCATTTCCTTGAGAA ATGGGAACAAATTGACCCTGGAACTGAAGTTTAACTGTGCTGAAAAGAAT CACTATGAAGCTGATGAGAGCACTGCATGACCAGTTTCAAGATGACTTCT CTTTGTAATATAGAATCAAGAAATCAAAGAGAAAAAAATTAAAATATCAA AGTGCTGAAACCAGTCAACATTTATATCCCCCTTAAATTCTTGGGAGTTT GTTAATCTGGCTTTGCTACTTTAGAAGTAACCCTGAGAAACTTGTATTTC TAACACTTCAAAATAAAGACTGAATCAAGTGAGAAGGTCAGAAAGCCTTC TGAAGATCTAATAACATCACAGGAGGAAGGAACCCAGGATGACAAATCTG TACTTTTGGCTAGTCAATAGCAGTTTTGAACATAGGCATCTCTATCTTGA GAGAAAAAAAAGAAAAAAATGCATATGAGATTATTTTTTTAGCCTTTTTG AATACACTAAACCATCTTTATTTGGTTATTTCTATTGACTTTATAATCTT ACTGACTCAGTGAAAGACTTCAAGAANACCAGCTTAGCACAACAATGCAA CTTGAATCAGCAAAGTAATGAATGTGTTGTTCTGTCAAATCCCATTTGCC ACAATAGCTCTGTCATTTTATTTGAAAAATATACAAACCTGGATTCCCAG CCCTGCTTAACAGCCAGGAGAACAAAGGGGGGACAGTCAAAAACAAATCT TCTATGCCATTATTTCAATTATTTTCTGCAAAAAAACTTTTCAAAAATTG GCCCCAATTTTGGCCCCTTGGTGTTTTAAAATAACAACAAAACTTGGAAA AATTTGGTAAAACCTGGCCAAATTTAAAAAGGCGGCTTTTGATTTTTTTC CCAAAGAAATTTCCGGCCGGGTGGGGTTGGTTTCTTTTTTTAATTTATTA TGAAAATTGGTTTTGAAAATATCCCGCGGGAAATATAGTGTTTTTGTGGG CTTTTGTGGGGGCCAAACTTTTTGAAGCGTGGAAAATATTTTTTAATATA AATCCCCAAAAATTTAAAAGGGGGGGGTTTTTTTTTTAAAGAGGGGGGAG AAAATAAAGCCAAATAAAAAACCCCCCCGCGAATCTTTTTACAAACAAAA TATATTGTTGTTTTTTGTTGTTTTAAAAAAGGGGGGGGGGGGGGGAGGGG TTAAATAAAATATTTTTTATATAAATTTCTCCCTCTTCCTTGCGGCGAAC AGAGAAGAAAAGAGGGTTTTTTTAAAAACCCCCATTTAAAGGGGGGGGGG GTTTTTATAAAAGACCGCCGCGCCCTGGTCCACTCTTTTTTTTTGTTTTT TTTTTTTTTCGCGAGAAACAAGAAAAAACAAAAAAATATTTTTTATTTTT TTTTTTTCCGGGGATCCCTCCCAGAAGACGGCCGCCGGGCGGCGAAAAAA AATTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAAAATTTAATAAAAATAG AATCTCTAATATAAAATAACAAAAACAAAAAAACAAGAACGTGCGGGTGG GGAGGGAGAATAATACTCCCCCTCCTCTCCCNNNACCGTGCCTACTAAAT ACTTTGATATATTGCTTTACTCGTGTATAATGTGTTATGATTAATATATT TGTTGATGTTTGTTTGAGAAGACTAGTAGTTATTGGAAGGTCAATGGAAT ACGCATAAGATTCGTATGTGACAAATTGCTAACAGTCTTAATCGTTGATC ACGGCCGCCTCTCTGACCCATACAGGCC project fbnt AH 20040903 8295bp GGGGGCGATGATGCAGTAGTTCTCAATGGAACTGTCAAATAATCTCTCAC TATGTCAGACTTTAGAAGCTAAATTATTAATTCAACCACATTTTCTCTCA CATCATTTATACAAAAGAAGTCAATTAAGTGGAATATTAAAAGCTGATGA ATCAAACACTGGCATAAAATAGCAATTAGAAAATAATCAGTTAATGAAGT AAAATGACAATTGAAAAGTCATCTAATGACAGTAATAGAACTAGTGCATT AACAAGAAGTGACACTGAAAAATAGAAATGCCAAATACAACAGTTATGAT GACTAAAACTGTATTAGAAAGATTCATACAGATAATTAAGTTAAAACACT CCAGTGCTTAGGATATCTTTCTGGTATTGTAACAAAAAAAAAAAACCTTA AATTTAGTCTGCTTTAGATATGACCTCCAAGTAAATACTCTCACATTTAT AAAGCTATCCTCTGAAAACTGTTGAAACTAGATAATGCAGTTTAAAAAAT ACTCATACCTAAATTTCATGAATATTAATATGTAAGATGCATATACATAG GCATAAGGAAAGGGCTCTTTCTTTCTTACAGGGCTTGCATTAATGGAAAA AGCCCTGACCACCATCAAATGGCTCAGAATGAGGGATAAAGCTGGTGTGT TGCTAGTTTGAAGTGAGGAATGTTAGGATGAATTGAAGTGATTAAATTTC CAGGATTTCTCCCTTCCCAAAAGACTCTCTGTAATATGTACAGGTTCTCT GTACATATGACAAAATTCTAAATGAGTTATCACCTCATCATCAGTTGTTG TTCAATTACTAAGTCATATCTGACACTTTACAACGCTATGGACTGCAGCA GGGAGGATTCCATATCCTTCACTATCTCCTGGGGTTTGCACAAATTCCTG TCCATTGAGTTGGTTATGTCATCCAACTATCTCATCCTCTGTCACACCTT CCCCTCTGCCCTCAATCTTTCCCAGCATCAGAGTATTTTCCAATGAGTAG ACTCTTTGCAACAGGTGGCCAAAGTATTGGAGCTTCAGCTTCATTCCTTC CAATGAATATTCAGGATTAATTTTCTTTAGGGTTGACTGATTTGATCACC CTGCAGTCCAAGGGACGCTCTAGAGTCTTCTCCAGCACCACAATTCAAAA ACATCAATTCTTTGGCACTCAGCCTTTTATACAGTCCAACTTGCACATCT GTACATGACTAGTGGAAAAACCTTAGTTTTCAAAATGCAGAACTTTGTCA GAAAAATAATGTCTCTGATTTTTAATAAGCTGTCTAGGTTTGTCATAGTT TTCCTTCCAAGGAGCAAGTGTCTTTTAATTTCATGGCTGCAGGTGGCACT TTTGGAAAATAACTCTCCTGCCAACACAGGAAACATAGGCTATGTAGTTT AGATCTTTGGTTGGGAAGATTCCATGGAGGAGGGCATGGCAATCCACACC AGTATTCTTGATTAGAGAATACCATGAACTGAGGAGCCTTGTGAGTTAAG GTCTGTAGGTTCTAAAAAAGTTGGACATGACTGAATCCACCTAGTATGTA CTCACAGAAGTAGGGTTGCTTGATGATATAGTAATCACGTTTTTCTTTGT GGAGGAAGGCTTCCCTGGTGGCTCAGATGCTAAAGAATCTGCTTGCAATG AAAGAGACCCAGGTTTGATCCCTGAGTTGGGAAGATCCCCTTGAGAAGGG AATACTACCCACTCTAGTATTCTTGCCTCAAGAATTCCATGGACAGAGGA GCCTAGAGGGCTACAGTCCATGAGGTTGCAAAGAGTCAGACATGACGGAG TGATTAAGATTTTCAGCATCAGTAATTAGTCTTAAATCTAAGAAAATCCT GTGAAAAAGTAAACAATGAAAAATGTAACTAATACACTTTTAGACATTAA ATGACATTTATGGTATTGGTACAGACTGTTTTTACAAAGATAATTTATTT TTTAAACTTTATTGGAGTATTTTATTTAAAACTTTGTGTTAGTTTCAGAT GTAAAGTCAAAATGAATCAGTTATACACATACAGATGTCTACTCATTCTT AGATTCTTTTCTCATATTGGTCATTCCAAATATTGAATAAAGTTCCAGTG CTATGCAGTAGGTCCTTAACTATTATACATAAAATTTATAGCTTTTAATT TGTTGATAGAATAAAGTGTCCATTTGTAATCCATCTACTTCCAGACTGGA AAAAAAGAAGTCAAAGTTACTATTTTTTTAATACTGAAATATTTATGAAT AATTGTCTCCTCCTCTTGGAACATTTTGAATGTTCATGTAATATTTTATT GATTCGGGTCATTTTTTGGTGAAAAGGATGAGATCTAGATTAAGTTATTT ATAGTTTGAATAGAATTTGATCTGATGATTCTGCTATCAATTTCTCCTTA TTTAAAAGACTTTCATCATTAGCTATGTCTCTATTTAAAGTGCTGACATG TAATATCACTATGTAGCATGAAGTAACTGCCCTATTACTATGATTCCTGA TTATACACACAACATATGAAATCAAAGTTCATTCTTTTTTTTCCTCACAT GATATATAATGGAATCAGTTTGAGCTAAAAACCATGGCTTATTTCAGAGG AATTGAAAATTAATGAATAACTATAGGACTCAACCCTCATGAGACAGGGT AAGAAAAACAAGTCAAATTATAAAATTGCTCTTAAGTTAAATAGTGCACA GCTTATGAACCAATACATGTCACCCGTGGAAAATATTATCCCTTGGAAAT GTCTTCAGGTTTCTTCCTACATGGATTATATACATCCTGATATATTTGAT ACTCTCTCCCCCTTTCTCTTTTTCATAAAGTTTTTTTTTTAAACCTGGTT CATGGATTTTTTAAAAATTATTCTTTAGATATGAATATTCATCTTCCTTT ATAGCCATTTTTATCTGGCTTTGCCCTATAAAAATTAGTAATGAAAAATA TTGGTTTTAGAAAAACCTTGCTTGTAAATGTTATTAAATATACAAATGTA AAGCAAACCCATTAATTAAAACTTATGGTGCCAACTCAAATGTGTATGCT TGTGCATACTAAGTTGCTTCAGTCGTGTCCAACTCTGTGTGACCCCATGA ACTGTAGCCCTCCAGGCTTCTCTGTCCATGGGATTCTCCAGCCAAGAATA GTAAGTAACCGTTAATTTTCTTGCTATAATAAGCACTTAAATAAAATAAC TTATGTCCACATTGGGCTTCCCTAGTCACTCAACTGGTAAAGATTCCACC CACAATCAGAACACCCCGATTCGATTCCTGGGTCTGGAAGACCCACTTGA GAGGGGATAGGCTACCCACTCCAGCACTCTTGGGCTTCCCTGGTGGCTCA GACAGTAAAGAATCTGCCTGCAACGTGGGAGACCTGGGTTTGATCCGTGG GTTGGGAAGATCCCACTCAATTATTCTGGCCTGGAGAATCCATAGACAGA AGAGCTTGGGGGGCTATAGTCCATGGGTCTTAAAGACTGAGCCACTTTCA TTTTCATGTTCACATTATAGTCAAGGTAATTCTAGTGTTGTGGGACCTAC TTCTTTCATAAGGATTACTTTTCATTTAATTTGAAAATGTACTCAGAGGT GAAGAGGGAGAATGTTCTTCCTCTGTGCCTAGGATGTTAATATCTATTAT GGCAACTGCCATAGAATGGGAAAAGTAGTACCTTCTCCATCATGAATGCT TAGGGTGTTTTTGTACTAATAGAAATTTTTAAATTAGTCCATCATGTATG TTTCTATGAATGTTTTAAAACACTTATGGTTGTGTAATGCCAATTTATAA AACAAAGAAGCAGATATCTGAGAAAAGTTATCCTAAACCAAAAAATTACA ATCCTTTAAATTTTTAAGGTTTTCCAAATTTCCTGATGGAGTATTTACCA CTAGAATTAAAAACAACCATTGCTATGTTTAAATATCCAAGATAGATTTT CTCTCCCTTTTTTTTCCCTTATAGTTTTATAATTGACAGGCACCTAAATA TATATATTATATATATATATATATATATGGAAACAGAGTACGTTTATATA TATATATATGTTATATATATATGTTCCATATACATATAAATATGGAAACA GAGTATGTTTCCATATTTCCTTTTCCTACCAGCTTGCTCTATAAGTACAC AGATCTGACTGTACTATTATTTTATCTGATGTTATATGAAAATTAATTTA CAGATGAAGGAATATATAAAATAATGTTTTAAGTGTAGATCCACCTAATC AAGGGCATACATGATATATTCTTGAAACATGAGTTGAGCAGATCTTGTTT CTTTGTGTGTCTTAAAAACATGAATAAGTATTTCCCATAAATATGTTGCA TAAATGGCTGCTATTACAAGTGTCAAAGGCAAAATTATGAAATAGCAATA TCTGTCACCATTTGCATATTTTATGATGTGCTATTGTTCACTAAATTCCA ATTTCTTGTTATTTTTATATATTTTCTACTCCAACTAAGGTTCTCTGTAA GGGTTTGTTCTCTGGATTTGGTTTTAAATCATTCACCTCCACATATGCAT AAACACAGAACATATCTTTGAAACAAAATCTTGTTTATATGTCAATTGAT AGGTAATTTAAAAGCAGAACTATTATGGTTGAAATACTGAAAAGGCCCCT GAGTCATCTTACCATGAATCATGCATTATAAGGTATGTTTTAGCTGAAAG TTACTATATTTAAAATTTTGTTTTCAACTGAATAGTCTACGCTTCTATCT TAAGACACTAGAAGAGCAAACTGAACATATATAAAAGGAAAATAATAAAA TTTGCACTGAAATTATGAAGTAGGTAATATTAAAACAGACAACTTCAACA AAAACACAAATATTTCTTTGTAAAAACTGACAACATAGACATATTTGAGC TAGACTTCACTTTCACTTTTCACTTTCATGTATTGGGAGAAGGAAATGGC ACTCCACTCCAGTGTTCTTGCCTGGAGAATCCTAGGGACAGGGGAGCCTG GTGGGCTGCTGTCTATAGGGTCGCACAGAGTCGGACACAACTGAAGCAAC TTAGCAGCAGCAGCAGTAGCAGCAGCAGCTAAAGATTAAAAAAAAAAAAA AACAATTTAAATTACAAAAATAAAAAAAAATAAGAGTAAACATCATCACC AATCTCACAGAAATGAAAATGATTTTAAGGGATTGTTATGAACAAGTACA CACTAATAAATTAGATAATTAGATTAGGTGAAATGCACAAAGAAAGATAG CATTAAGTCATGTCGAACTCTTGGGATCTCATAAACGGTAGCCTGCCAGA CTCCTCTGTCCATGGGATTCTCCAGGAAAGAATAATGGACTGGTTTGCCA TTTCCTTCTCCAGGGGAACTTCTCAATCCAGGAACTGAACCCAGGTCTCC CACATTGAGGGCAGATATTTTAATGACTAAGCTACGTGGGAAACAGGGAA ATGCACAAGTTGATAGAAAATCAAAAGGGCCACATATGGCTAAATAAGAA ATGAAAAATTTGAATAGATATTTCCTAGTAAAGGGGCTTCCCAGGTGGCG CTAGCGGTTAAGAATCTGCCTGCCAATGCAAGTGGAGAAGGAGATGGCAA CCTATTCCAGTATTCTTGCCTGGAGAATCCCGTGGACACAGGAGCCTGCT GGGCTGCTCTCCATGAGGTCGCACGGTTGGACATGACTGAAACGACTTAG CAGCAGCAGCAGCAGTCAGTGCAGCAGACAGAAGAAATGTAAGTTCTATT CCTGGGTTGGGGAGATACCCTGGAGGAGGAAATGGCAACCCACTCCAGTA TTCTTGCCTGGAGAATTCCATGGACAGAGAAGTCTAGTAGGCTACAGTCC ATGGGGTCACAAAGAGGCAGATACATCTGAATACACACACACACACACAA GTAAAAAAGGGGCTTACAAAGAAAATGCCAGGACCAAGTTAGTGTGGCAT GGGCATAGGGGGAGAGAGAGAGAGAGAGAGATCAGTAGAATAGAATTGAA AATACAAAAGTAAACCATTGCACCTGTGGGGCTTGCAAATATGCCCAGTT TAAATTATTTTCAACAAATATGACACTGAGAAAACTGAATACCCAAATGT AAATGAATGATTCCCCTACCCCACATCTTGTGTGTGTTAGTCGCTCAGTC AAGTCTAACTCTATGTGACACCATGGACTGTAGCCCACAATGGGATTCTC CAGGCAAGAATACTGGAGTGAGTTGCCATGCCCTCCTCCAAGGGACCCTA CCCCCAGGCATTGAACCCAGGTCTCCTGCATTGCAGGAGAACACTTTACC ATCTGAGCCACAACACCTTACATAGAAATTAATTGAAGATGCATTACAAA CCTAAATTTAAGATCTAAATCTACAAAATCTTGGAATACATAGACAATAG TTTCTTAGTTCTCCCAGCAAAATTTCATGTTACCAAAAAAAGAGATATAT TTGACTTCATCACAACTGAAAACTTTTGTGTTGCATATACTAACATCAAT AAAGTGAGAATACAACCACTGACTGCAAGAAAATATTTGCAAATCACAAA TGTGATAAGGGACTTGTTTTCAGAATATATAATGAATTATTAAAACTCAG CAAAAAAAGACAAATGAAAACAAATAACCAAAATAATGGATGAAGATTAT GAATATACACTTGGATAAAGGAGAGATAAAAATCTCCAATAAACAGAAAA CAAGAATCTCAACATCTTTTCCAACCAGGAAAATGAAAATTTAAAATGTG TTTTAAAATGTTCTACCACTTGAATTGTGGTAATAGTTGCATTGTCCTGT GAGGATACTAAAAATAACATTGAATAATACACTTGAATGAATGAATTTTA TGATGTTTGAATAATATCTCAATAAAATTTTAAAATAAATGATCCATGTG AGAAAGCATATTTTAAATTTTAAAAAACAAATTAATCTCCAGTAATTAGA CAAAGTGATTTTTTCCTAAACAACAGAGTAACAGAGATGAAATAAGAAAA TTACAATGAAAATGCAAATATATTAATTTTATTGTTGTTTAGTCACTAAG TCATGTCTGACTCTTCTGCAACCCCATGGACTCTAGCCCTCCAGGCTCCT CTGTCTATGGAATTTCACAGGCAAGAATATTGGAGTGGGTTTCCATTTCC TTCTCCAGGGGATCTTCCTGACTCAAGGACTGATCCTATATTTCCTGCAT TGGCAGGCAGATTCTTTATCACTGAACCACCAGGGAAGCCCATAAATAAA TTAATATAAAGCTTAATTTGTTATTGTATCTCATAATGATCAGTGTTTTC ATGTATTTCTTAAGTTCATAACATTTTTAACTATAAATATTTTGCTACCA TATTTTTTTTAGCATTTTCTAAGTATCATATTAACCTGTTAAATACTAAC TTTTCTAAAAATAATTATTATCTGGATGTTAAATTTTAATATTAATGTAA TTATTAATAAGTTACCTAGATAAGAAAGAATTAGGGTAAAATAAAATGCA ATTTGAACCTAAACACATTGAGATAATCTGACCCAGATATTGGTCATAGG TGTCCCTTATCCATATCATTTTGACTCAAAATTTATGAATATATAAACAT GTGTATCACACATTTATTAAAATTATATAGAAATTATGATTTGTAAAACT AGAAAATGTGAATGCTAAATGAAGATTAAACTATCATAATAATATTCTTA TTGATTGGTAATTATATATTATCCTTTATAAGACACAGTATTATGAACTA ATCAGCCTATGACACAGTATATGCTTTGTCATTTTACCTCAGAACTGTCT TCTGTCTTCAATTTTTTTTATTTCTAGTTCTGTATGCTTTCTTGAGCCAT CTTTCTGAAAATTTAAGGATTTCTCTATTTTTTTCTGGTCATATTATAAT AAATTCCTTTGCAGTGGAACCTGTAATTTGGGAAAGAAAAAAAAATATTA CAAGGAGAAAAAAATTTGGTGAAAATTTTTCCTATTAAAAAAGGGGAAAC TTCTTCCTACGTTTCTAATTTTTTCCTAAAATTTAGAAAGGGGAAGTGAA AAGTGTAAGGGGCCCAAAGGTTTCTAACATATTTACTAATAAAAAAAAAA AAAAGGGGCAATTTTTGGGCCCTTTTATATTTTTTTTTTTTCTTTTTGTG TTTAAATTTTTAAAATTTTTTAGGGGGAAAAATAAAAAAAAAAAAAAAAG GGGCTTCTTTATAAAGAGGTGCAAAATTTTTGGGGGGGGGAAAAAAAAAA CAAAAAAAAAAAATTATTTTTTTTTTTGTATAAAAAAAAAAACTA project fbnt AI 20040903 7347bp GGTGCCTCTTCCCCTGATAAACAAGTCGCCCGACAAATTATTTTTAGGAA AAGGTGGAGGCACAAAAATTATTGATAAAACTTTTTTTCACAAAATACAG TCTTTATTTGCCCCATATATAACCGGATTGCGGGTGTTTCCTTCCTCTTA GATGCCCGAGTGGGCCCCTCCACAAGGAGCTTTTGAAAGATTCCCCTTAA ACAAATTTTATGTGTGGGTGACGAAATTCCGGGCGACTTTTTCCAATTTT TAAAAAATTGCGCATTGAAAAATGTGCCTCTCCGGTACCCCACCACCGTG AAAATTCAACCGGGGGCCCCGGGCCGGAAAAAAATCAATTTTTTTCCATT CCCCCGAGAAAGGCAATACCAAAGAATGGAATTTTCAAGATTCTGACCCA GTGGCACTGCATCTTCCAAGCTAGGCAAAGTAATGCTTCAAATCCTTCCA ATCCAGGACTTCAACCGTACCTGACCAAGGAACTTCCAGAAGTTCAAGCT GGATTTAGAAAAGCCAGAGGAACTTGAGATCAAACTGCCACCATCGATTG GATCATTAGAAAAAGTAAGAGTTCCTGAAAAAAACATAAACTTCAGTTTT ATTGACTAACTCAAAGCCTTTGACTGTGTGGATCACAACAAACAGGAAAA TTCTTCAAGAGTTGGGAATACCAGATCATCTGACCTGCCTCCTGAGAAAT CTGTATGCAAGTAAAGAAGCAGCAGTTAGAACTGGACATGGAACAACAGA CTGGTTCCAAATTGGGAAAGGAGTACATCAAGGCTGTATATTGTCACCCT GCTTATTTAACTTATATGCAGTGTACATCATGTGAAATGCTGGACTGATG AAGCAGAAGCTGGAATCAAGATTGCCGCGAGATATATCAATAACCTCAGA TATGCAGATGACACCATCTCCTCCCTCCCCATACCATCCCTCTGGGCCGT CCCAGTGCACCAGCCCCAAGCATCCAGCATCGTGCATCGAACCTGGACTG GCAACTCGTTTCATACATGATATTTTACATGTTTCATTGCCATTCTCCCA AATCTTCCCACTCTCTCCCTCTCCCACAGAGTCCATAAGACTGTTCTATA CATCAGTGTCTCTTTTGCTGTCTCGTACACCAGGTTATTGTTACTATCTT TCTAAATTCCATATATATGCGTTAGTATACTGTATTTATGTTTTTCCTTC TGGCTTACTTCATTCTGTATAATAGGCTCCAGTTTCATCCACCTCATTAG AACTGATTCAAATGTATTCTTTTTAATGGCTGAGTAATACTCCATTGTGT ATATGTACCACAGCTTTCTTATCCATTCATCTGCTGATGGACATCTAGGT TGCTTCCATGTCTTGGCTATTATAAACAGTGCTGCGATGAACATTGGGGT ACACGTGTCTCTTTCCCTTCTGGTTTCCTCAGTGTGTATGCCCAGCAGTG GGGTTGCTGGATCATAAGGCAGTTCTATTACTCCATTTCTTCTAAGGCAT TCTTGCCCCACAGTAGTTGATCTAATGGTCATCTGAAAAAATTTGCCCAT TCCAGTCCGTTTTCATTCACTGATGCCTCAAATGTTAATATTCACTCTTT GCCCTCACCCAGTTTGACCATTTCCAAATTGGCCTTGATTCAAGGGACCT AACATTTCAGGTTCCTATGCAATATTGTTATTTACAGCATTGGACTTTAC TTCCATCACCAGTCACATCCACAACTGGGTATTGTTTTTTCTTTGGCTCC ATCTCTTCATTCTATTTGGAGTTATTTCTCCACTCTTCTCCAGTAGCATA TTGGGCATCTATCTACCTGGGGAGTTCATCTTTCAGTTTCCTATCTTTTT GTCTTTTCATATTGTTCATGGAGCTCTCAAGGCAAGAAAACTGAAGTGAT TTGCCATTCCTTTCTCCAGTGGACCACATTTTGTCAGAACTCTCCACCAT GAATGTTTTCATTCCTACATGAAGGAATGAATTCCTAAATGTGGCGTTAC ATGGCATGGCTCATAGTTTCCTTGAGTTAGACAAGGTTGTGGCCCATGAG GTCAGTTTGATTAGTTTTATGTGATTGTGGTTTCATTCTGCCTGCCTTCT GAGGGATAAGGACTTCCCTGATAGCTCAGTTGGTATAGAATTCACCTGCA ATGCAGGAAACCCCAGTTGGGTTCCTGGGTCAGGAAGATCCCCTGGAGAA GGGAAAGGCTACCAACTACATTATTCTTGGGCTTCGCTTGTGGCTCAGCT GGTAAAGAATACATCTACAATGCAAGAAACCTGGGTTCGATCCCTGGGTT GGGAAGATCTGGAGAAGGGAAAGGCTACCCACTCCATTATTCTGGCCTAG AGAATTCCATGCACAGTCCATGGGGTTGCAAAAAGTGGGACAAGACTCAG CAACTTTCACTTTCAAAGGGATAAGGATAAGAGGCTTGTGGAAGCTTCCT GATAGGAGAGACTGACTATAAGGGAAACAGGGTCTTGTTTTGATGAGTGG AGCCATGGTCAATATATCTCTAATCCAATTTTCTGTTGATGGGCAGGGCT GTGTTCCCTCCCTGTTGTTTGACCTGAGACCAAACTATGGTGGAGATGAT GAAGATAATGGTGACCTCCTTCAAAACTTATATAGGACTGGAAAACAGAC TCTTGGAGGGCAACAACAAAACCTTGTGCACACCAGGACCCAGGAGAAAG GAGCAGTGATGCCACAGGAGGCTGACCCAGTCTTGCCTGTGAGCATCCAG TAGTCTCTGGCAGAGGCAGGGGTTGGCAGTAGCCTGCTGCAGGGTCGGGG ACATTGCAGCAGTACATGCATGGGACCTTTTGAAGGAGGTCTCCATTATC TTCATCATAATCAGTAAAACTTAAAATTATTTTATTGTGACCATTCTCAT TGGTTCATATAACAGGAAAAAAGAAAAATGATCAATTTTAGTACAGCCTG ATTCATAAATAGGCAATAATCTAGATCAAAATCACCAGATCAAAACTGAT ATATCTTTAAAATATGCCATTTATGATCATTAATTTTACATGTCAACTTG GCTGACCATAAAGTACCCAGGTTACTTTATTTCTGGGTGTGCTGTGAGAG TGTTTTGGGACCAAATTAGCATTTGAATCAGTGGACTCAATAGATTTCCC GCCCCAGTTTTGTTCAGTGTGCGACCCCAGAGAGGACAGCCCACCAGGCT CCCCCGTCCCTGGGATTCTCCAGGCAAGAACACTGGAGTGGGTTGCCATT TCCTTCTCCAATCATACAGTTAGAGAAAGTGACAAAAACAAAAGGCTAAG TGAACTGGAACATTTCATCTTCTTCTCCCCTTAGATTGTGATTTACTGTA TTGACTGCCTTGGTTCCCAGACTCCGAATGAATCATACCACAATTTTTCC TGGGTCTCCAGCTTACAGATAGCAGATGACAGCCACGCCTCTCTCTTTCT CTCTCTCCCTCTCTCTCTCTCTCTGCGTGGGTGTGGGTATGTGTGCACGC ATGCATGCACCTTGGTGGCTTGGTCGATAAAGAGTCTGCCAGCAATGCAG CAGTCCCAGGTTCAATCTCTGGATTGGAAGATTTCCTGGAGGAGAAAATA GTAATCCACTCCAGTATTCTTGCCTGGGAAATCCCTTGGAAAGAGGAATC TGACAGGCTATATAGTCCATGGAGTCACACAGAGTCAGATATGACTGAGC AACTAATACTTACTTTCACTTTCACATGTGTGTGTATATATATATATATA TATATATATATATATATATATATATATCCTAGGGGGTGTGTTGCTCTGGA ATACTATGACTAATATACTATGAAATCATTTTATTGAATAATTTTACAAG TATGATAAAAAGTAAGAAAATAGTCTCTTTCTGGCTTCATGGTTGATAAC ATTCACCAAGTAAGGAAAAGCTGGAAGACCAGGTTTAGAGTGAAACTGTT AATCTGGTTCTGGATATATTTAACTTCTGTTCTGTTCTCAGTACAGTGCC ACTAAATGTGTAATATTTAAATCTTTATTNTAATAATTCATTAATTCAAC AAATATGTATTAAATATATGCATATTATAAGTAAGAAAAGTAAAGCTAAC AGTTATAACTGTAGCTTTCATATTCAAAGGTCTAATGGCAGGGAAGTAAA ATGAAAGATGAATCACATAATTATGTATGAAGTTAGGCCAGTGATAAGGG CAATGAAGGAAAACAGCATGGATTATAATAACATTAATAAGAGTTTTGAC ATCAACAGGAAGGTTTTGGAAAAGCTTTTATTAATAGATAATACACACAT ATGCAAATATAGAAGGTTCAATAATTAATAAGGTCATCTTTTAAGAGAAA GAAGAGTGCCTATGATAGAACATTTTGAAACTCAAATATTTAATCATCCA ATTAAGACTGATGAACCAGAAAATGGGATAGAAAAAGAAGAATGGAAGGT AGTTAAACCATGTATTCTGAGAAAGGAAAGTATTTCTAAAGGAGAGGGCA TTAAAGAAGAGAGTTACTGAATATCCTATAAGGACAAGAAATGGCATTTC CATTTATTTAGAAGCATGGTAGTAATAGAGAATGGCTTTCTTAAAATCGG GCAAATAAAAGCCAAAATAGAATTGATTTAAAGAATTAGTTAAAGTAGAA GGATAGTTATAGAACAGAAGATGATGATTTTAAATGGTACTGAGAAAGTA AAAATTAGTAGATTTTATGATTAATTTTCTTTGGTGGAGGAGTAAAAATA AGACTATTGTTATGGATGACTTCTAGGTTTTTAGTTTGTTGTGATTAATA CTTTCTGAGAGAAGACTAGATTTTGGGGGGGGGGAATTATGAACTTAATT TTTGACATGTTTGAGTCAACCAACTGTTGATTTATTTAATAAGCCATTGG ATAAGTAGTATGCTGATCAGAAAAGAAGCCCATCTAAGGGTATTTTCAGA AATACTTATTACACAGGTGCTAACTGAAAGCAAATAATAAGAAGGGTAAG AATAGCCTGGATCATAACTGTGTGGTGTGGAAAGACACATTTTATTTTAA GCTGAGGAGGGTTATTTAAATGTGAAAAGTATGAATATTAAAGAAGAAAT ATTTCACTCATAGCTGAGGAGATGAATGGATGATAATCATAGTATCTGTG GATGAGAACAACTGCATAAGTTATTGGCCTTAAATAAGAGTCAGCTCTTT TATAGTAAACTTTCATATTTTTTAGCAGATGGATGAGAGAAATGTCTTCT TGTGTCTTTCACTTTCCTAAGTTAAGATCTAAATTTATGTTTTGAGACTG AGTGGAACATTGAGCAAATAGGAGACTGGGAGAGGATAGACTATTTTCTA TAAACTAAGAACCACAGTAGTCACTACCATGAAGGACTGAGAAGGAGTAA AACATACGGCCCATTATTTTTAAGGAATTTAAGAAATACAAACTTAAAAA ACAAATAAAACTTCTAAAGATAAATGTATGCTGATGAAGCAAAGAAGTAG ACCTGTTTGCTTTGGGTTGAGAGAACACTATAAAATGTGGGACATGAAAG CAGATATAATTTCATAAGAGATAAATAATGAGGGGATTCTTTGATAGAAA AAGTTATAACCAAATGGATATAGTAGATAAGCATATGGTATTATTTCTTA CTGAAGGATACTGTAACAATTTACCATACTGGATGGCTTAAAAAGTAGGA ATTATATTTGTTACACTTCTGAAGACTTAGAAGTCCAATATCAAGGCACT GGGAAATCTAGAATATGGTGAAAGGCCAATTCTTGATTGGCAGATTGTAG CCTTCTCATTGGATCCTCATATGGCAAAACATCAGAGAGCAAGATCATGT TCTCTAACCTCTTCTTTGTTGTTATTCAGTCACTAAGTCATGTCCAACTC TTTGAAATTCCATGAACTGCAGCATGCCAGACTTCCCTGTCATTCACCAT CTCCCAGAATTTGATCAAACTCCTGTCCATTGAGTCAGTGATGCCATCCA ACTATCTCATCCTCTGTCATCCTCTTCTCCTCCTGTCTTCAACCTTTCAC AGAATCAGGGTCTTTTCTCTTCTTATAAGGGCACTAATCCTGTTCACGAG GGTTCCACCTTCAAGACCTAATTACTTATAAAATCCTCCACTTTAAACAC CATCACACTGCAGCTTAGGATTACAACATGCAAATTTGTGGAGGCTAGAA ATGTTCCCTCCATAGCACAGTGACAGCAAATATTGTGTGTCCTGTATGGA ATATGGACTTTGGAGGGAAAAAAGAACAAATTTGCATGGGACCTGAATAC AAAAGACTTTAAAATTTGACACTGTATTTTATTTCAAATAAAGAGTCATA TTTTTCATTCTTGAACATTAGGAAATGATGAATTCATTATGATGTTTAAC GAATGTTAGTTTAAAACTAGTTTGAAAGGTATTTTACGGTTTGGAGGGCC AGTTATTGAAGCAAATCCTGGAAAACTGTTGTAACAATCAAAATGTGAGG CAATGGATACCTGTATTAGAGTGATAGCAGAAAGGGGGATAGTCTGGGCT TGAACTTGGAAGACATTCTAAAGACTTAATAAAGTTTTGAAATTCTTTGT TGAAGTTTTACTACCTGGGTAATTGTTTTCTTTTTCTGTTGAGTCAGTCC AAAAAAGGATCCAGAATAAGAAGATGGCCTTTATTAAATAAGGAAGATTA TTGAACCATCTAAGTAACAGTGCTATTATTTCTTATTGCTCTAACTATGC AAGTGAGCTTTGTTTTATTTCCTGAATAAATGCTGATGGACAGAACTTAT TCTGATGCATGAGAAATAGTATTCAGTATAATTTTGTAGTTGTCTCATTT AGCACTTCTTTAGTTAAGCAACAGTAAAATGCTCTCTGAAGACATATTAA GTTGCTTGAGAAAATAATGTTGGTCTTCAACAAAATGTCCTCCTTTCAAC TTATGGTTTTAATTTGTTTACATTGTTTAAGTCTCAGAACTTAAGGAACA TAATCAACTTGGTACTGGAAAAAAAAAAAAAACAAATATTCTAAAACATC TGTTTTCAAAAGTTAATTTGACTGCCTGACTTCAGGATCTACTACAAAAC CACAGTCATCAAGACAGTATGGTACTGGCACAAGGACAGAAATACAGATC AATGGAACAAAATAGAAAGCCCAAAGATAAATCCATGCACCTATGGACAC CTTATCTTTGACAAAGGAGGTAAGAATATACAATAGAGAAAAGACAACCT CTTTAACAAGTGGTGCTGGGAAAACTGGTCAACCACTTGTAAAAGAATGA AATTAGAACACTTTCTAACACTATGAGAACTACTGACCTCGAGCCCC project fbnt AJ 20040903 6533bp GGGGCCCCAAAGGTCGTAGTTCTCATTGGTATAGAATACTTTTATGAGGG GTGAATTGCAATGAAATACCCCCCGTATTCTCAGTTGTTCAAAGTTCACT GGAAAAGTTATAGCCTTAATGAGAAAATGTGGTGACAAAGCAGTATGTAT TTTCAAAAGGATATCTGTGATCATGCCATTCTATCCCCTTAATGCATTTA ATATTTTGAGTATATCAGTTACTTGCTTGTTAAAAAAAACCACACTTTTC TTGTGGGGATTTAGTAAGCAGTAGTTAAAGTTGGTAAGTTAAGCTTCATT AAATAAACCTCTTGGGACAGCCACTCTAAAATCCCATTGTCTACAATAAT GTTTCTCAACCTTTTATTCCTTATCATTCTCATAAGAAGAAACATTAAAT TAAATTTAAATTATTTATATCCATAATGAATGTGATACAAACACACATTT ATTTTTCCTTTAGCAGCATTGGGTTGTTTGTGTTTCTACTCAAGTGACTT ATTCTGGAGCCCAAATTGAAGGAGTAGACCTTATTTGTTACAACCTGTTG TTGAATCAAAAAGGATGAGAAGTTGTAAAGGTACTTAATGATTCTTAAAC TGTATGCTTAGGCTGTTGAAAGTCACTTGGCCAGAGCAAGTTAAATGGCC AAGCACGAACAGATGAGATGGGGAAAAATCTCCTTCCTATAGAAAATCTA CACAAGTCTTGATGATGGGATGAGGGTAAGGAATCATGACAAGGATGATG GGCAAGTGAAAAAAATGGAAACATGAGTACCATCCACATGAAAGCAGGGA TGTTGAAAGCAGGCCAACAATGTTTGATTTCTGTTTCCTTAACTAGCTGG ATGACCTATAAAAACACTTAACTCCTTTATAATTGATTTCCCTCCTCTGC AAAAAGGGAAAACTGAAGGTTCTTATACAATAGGAGAGTTGGAAATACAC AGAAGAACTTCAAAAAAGATCTTCACGACCCAGATAATCATGATGATGTG ATCACTCACCTAGAGCCAGACATCCTGGAATGTGAAGCCAAGTGGGCCTT AGGAAGCATCACTATGAAAAAAGTAAGTGGAGGTAATAGAATTGCAGTTG AGCCATTTCAAATCCTTAAAGATGATGCTGTAAAGGTGCTGCACTCAATA TGCTAGCAAATTTGGAAAACTCAGCAGTGGCCACAGGACTGGAAAAGGTC AGTTTACATTCCAATCATAAAGAAAGGCAATGCCAAAGAATGCTCAAACT ACTGCATATTTGCACTGATCTCACATGCTAGTAAAATAATGCTCAAAATT CTCCAAGCCAGGCTTCAGCAATACGTCAACCGTGAACTTCCAGATGTTCA AACTGGTTTTAGAAAGGGCAGAGGAACCAGAGATCAAATTGCAACATCCA CTGGATCATGAAGAAGCGAGAGAGCTCCAGAAGAACATCTATTTCTGCTT TATTGACTATGCAAAAGCCTTTGACTTTGTGGATCACAGTAAACTATGGA AGATTATGAAAGAAATGGTTTTTGAGTTTCAGCTTCAACATTATCCTTGG AAGGATATCCTTGGAAGGAATATTCAGGACAGATTTCCTTTAGGATGGAC TAGTTAGATCTACTTGCTGTCCAAGGGCTCTCAAGAGTCTTCTCCAATTT TTCAGTGCTCAGCTTTCTTTATAGTCCAACTCTCACATACATACATGACT GCTGGAACAACCATAGCCTTGACTAGACAGAACTTTTTTAGCAAAGTAAA GTCTCCGCTTTTTAATATGCTGTCTAGGTTGGTCATAGCTTTTCTCCCAA GGAGCAAGCATCTTTTAATTTCATGGCTGCAGTTGCAACCTGCAGTGATT TTGGAGCCCCAAAAAATAAAGTCTGACACTGTTTCCTCATCTATTTTCCA TGAAGTGATAGACTGGATACCATGATCTTAGTTTTCTGAATGTTGAGCTG TAAGCCAACATTTTCACTCTCCTCTTTCACTTTCACCAAGAGGCTCTTTA GTTCTTCTTCACTTTCTGCCATAAGGGTGGTGTCATTTGCGTATCTGAGG CTATTGATATTTCTACCAGCAATCTTGATTCCGGCTTGTGCGTCACCCAG CCCGACATTTCTCATGATGTACTCTGCATATAAGTTAAATAATCAGGGCA ACAACATACAGCCTTGATGTCCTCCTTTTCCTATTTGGAACCAGTCTGTT TTTCCATGTCTAGTTCTAACTGTTGCTTCCTGACCTGCATACAGATTTCT CAAGAGGCAGGTCAGGTGGTCTGGTATTCCCATCTCTTTCAGAATTTTCC AGAGTTTATTGTGATCCACATAGTCAAAGGCTTTGGCATAGTCAATAAAG CAGAAATAGATATTTTTATGGAACTTTCTTGCTTTTTTGATGATCCAGTG GATGTTAGCAATTTGATCTCTGGTTCCTCTGCCTTTTCTCTGAGAGGCCT AATACTTTTACAAACTTATTTTGAAAGCAGTATCTCGCTCTTTTTTTGAA AATACTGCATTTTCCTATGGGTTACAAAACCTGAGGATAGTTTCTTTTCA TAACTATTCCAAATGCTTACTTTCTCAGGTTTATTTATTTATTTATTTAT TTTCTGGAGACTAATCATCTTTCATGTAAGTATAAATCTGACTTCTGGTA CTGAGTTTGAATTGGTAGCTTGGTCTAGAGGAAGCCTTTTGAGAAAAAAG ATAAAACTGGGTACCATAAAAATATTAGCTTTTGAAAATATCAAAGAGCT GTGATCAAAGTTCAATAATGAACATGGTGATTGGGGATGGAGCATGATGC TAAAGAGGAGTAAAATGACTTATTGACTTACACATGCCTGACATTCTCTG CGTGGTCTTCCCTGGTGGATCAGTGGTAAAGGATCTGCCTGCTAATGCAG GGGATGCAAGTTTGATCCCTGAAAGAGTCCCTGGAGAAAGACATGGCAAT CCACTAAGGATTCTAGCTTGGAGAATCCCATGGACAGAGGAAGCCTAGCA GGCTACAGTCCAGAGGGTTGCAGAGTCAGACACAACTGAGTAACTAAGCA TGGCACAACACAGTAATTCCTAACTTGAAAGCTATTTTGGGATATCGTGC TGTCTGCAAACATCCTTTTGAAGCATATTTTGTTATTTATACAGTTATTT GATCAATTTTTATTTCTGGTTTTGTTTTCTTTTTTTGAGAAGCATAAGTT CTGGAAGAATAAGTATTTCTTTTGATATATTGGAAGAAGAAATTTTCTTT TAAAGTACTTATGTTTAATAATTTGATAGTGGACTAGTTTTGCGCTGCTA CATGTTTAAGTTGGCGTTCAGCGTATTCACTCTTCACAAGTTTTAAAATT ATAATTTGACTTCCTATAGTCATTTATAACTTAAAGGAAAAAGGGGAATT TACATAAATTATTTTGATACATCTGTGCTTGAGACATACTATAGAATTGA GAGCTTTGGACAAATGTATATCCATTTGTTGAAATGAATGTTTATTAACT AGTTAAGATGCTGAGCTTTGTTATTTTTGTACTCTAACAGCAATCTTTTA GCTTTATAAAATAACGTTTTGTCAACTATAATTCAAACATCGGGTTTCAG TTGTCTGAAGAAATCTAAGTAGAAAGAAGGAGAGGGAAATAAACTCAAAT TTTAAGAACACATAAGAACATTCTGTTCTTACTGTTTCAATTATATGTAT TATCTAACATGATCAAGAAAAATATTTAATATGACAAATAGTAAATTCTT TTTTTTCCAATAGGTTTCAAAACACAGCAGGTTTATGTGAGAAAGGAAGT TAACAGGTACCATTAATCTTTTATCATGAAGTTACATGATTCTTGTTCCA TGATTAGTAATCAGACACTCAATTCTAGGTCTATTTACAAGAAAAAAAAA ATCAAAATAACTGAATGCTAACTGCTGAGCTAGTAACAAACAACTTTTTT TTTTCTTTCTGTTCTATGAAGATTTCCTTTTCATTTAAAGGAAGGAATGT GAAGTAAGCCAAAAAGAAAAACACCAATACAGTATAGTAACACATATATA TGGAATTTAGAAAGATGGTAACAACAACCCTGTATGCGAGACAGCAAAAG AGACACAGATGTATGTAAGAGTCTTTTAGACTCTGTGGGAGAGGTACGGG GGGGATGATTTAGGAGAATGGCATTAAAATATGTATAATTTCATAAAAAA AATAAATAAATAAAGGAAGGAAGGAATGTTTATAATCATCACTGGATTCA GCCTGGGGAAGCTATCCAGAGTTTTATATATATATATATATATATATATA TATATATATATATATATAAATGAAGTGAAGTGGTAGACACTCCATTGTAT GTGACTCTTTGTGACTCCATGGACTATAGCCCACCACGCTCCTCTGTCCA GAGGGGTTCTCCATGCAAGAATAGTGGAGTGGGTTGCCACTCTCTTCTCC AGAATATCTTCCTGACCCAGGAATTGAACCTGAGACTTCTGCATTGCAGT TCGATTCTTTACCATCAGAGCCACCAGGGAAGCCCATATAAATATGCATA TATAAGCTTTCCATCAAATTTTGGTTTGCATTAGGAATCATTGCTTATTT GTGAAATTTTTACTATTAAAACTGAAATTATATCACCATATCTATTTCCT TAAAAATTCTGAATTAGCATACATTCAGAGATAAAATTAATAAATGTAAA TGTATTCCAAACAAAGAAAAATGGTATGACTGTGAGAGCATGCTCAATAA AATGTTTATGCACACATAAACATTTGGAAGCTGTCTAACTTGAAAATCAT AAGTATAATTAAAATTATTTGTTGAGACAAACTCTAATCTAGAAAGAAAA CAATATCTATTGTATTCTTTAATATGTGTATAAATATGCATAGCATATAA AAAGTTTTGTTGGGAAAAGGTGAAACTGTTGTTCAGAGGTTTCAGACTTT CAGTTATAAAATAAATAGACAATATACAGCAAGGTGACTACAGTAATAAT AATATAGTATGTAATTTGAGAATAAAGAAGCTATTGATGAGAATGAAACA GAGGAGTGAAAAAGTTGGTTTAAAATTCAACATTCCAAAAACTAAGATTA TGGCATCCAGTCCCACCACTTCACGGCAAATAGATAGGGAAACTTCAATG AAAACAGTGACAGATTTTATTTTCTTGGGCTCCAAAATCACTGCAGATGG TGACTGCAGCCATGAAATCAAAAGATGCTTGCTCCTTGGAAGAAAAGCTT TTACCAACCTAGACAGTATATTAAAAAGCAGAGACGTTACTTTGCTGACA AAGGTCCATCTAGTCAAAGCTATGTTTTTTTTTTCTTTCCAGTAGTCATG TATGGGTGTGGGAGTTGGACTACAAAGAAAGCTGAGCTCTGAAGAATTGA TGATTTTGAATCAATTGGAGAAGACTCTTGAGAGTCCCTTGGATGGCAAG GAGATCAAACCAGTCAATCCTAAAGGAAGTCAGTCCTGAACATACATTGG AAGGACTGACATTGAAGCTGAAATTCCAATACTTTGGCCATCTGATGTGA AGAACTGATTCATTTGAAAAGTCCCTAATGATGGGAAAGATTGAAGGCAG GAGGAAAAGGGGACAACAGAGGGTGATACGGTTGGATGGTATCCTCAACA CAATGGACATGAGTCTGAGCAAGCTCTGGGAGTTGACGATGGACAGGGAA GCCTGGCGTGCTGCAGTTCATGAAGTCGCAAAGTGTTGGACACGACTGAG TGACTGAACTGAAGTGATGTACTTTGAGGACGTCCCAGCTGGCAATAGTG GTATAAAATATGCCTGCCAATGCAGGAGACTGGGTCAGGAAAATTCCTCA GAGGATGGCATAGCAAACCACTCCAGTATTCTGGTCTGGAGAATCCCGTG GACAGAGGAGCCTGGAAGGCTGTGTTCCATAGTGTTGCAAAGAGTTTGGC AGGACTGAAGTGACTTAGCACTTGTGCATATACTTTGAATTTCCTAATAG AATGGACCCCAAGAGTTCTCATTATAACTTTGTGAATTGGCTCTTTGTAG AGGACAGATCACTTAGCAACTCGTACCTATTATACAAACATTGGTGCTTA ATCTATGTGAAATGGAAGTCCATCAAAGTGGTTTGATTAATAGAATGAGA TAACATGACAAGTTATTCAAAGATTACTTTGATGTCTGAGTAACATTAGA TCATAGAGAATGAGAGGGAAAGCAGAAAGACCAAATACAGTCACTACACT ACTTGCTGTAAGAAATCTGAAATGAAATTATAGTCTTTATATGAAAAAGT AAAATTCTAGTAGTTCATTAAAGAAATCCATATTTCTAAAAGATAACATG GCCTCCATATTTTTGGAACTCTCACTGATTTTCATCCTTGTATGCAGTAC CAAGAAATTAATTTTGTTTAAATCTCTTTTTTAGGAGACTTTGGTAAAAA AAAAAAAAAAAAAACCTGCCAAGGCTGGAGACATAAGAGGAGTAGGTTTG ATACCTGGGATGGAAAGATATGATGAACTACTG project fbnt AK 20040903 4768bp GGGGGGCCTCTAATGGGTAAGATAGTTCATCAAAAGAGTCGGACATGACT AAGCGACTGATCTGATCTGATAGTGAATTTCCATTAAATATGGTGAAGCT TCATTTTTAATTTCACCTTTTACTTTTTATATTTGAGTGTGACTACTGGG AGCATTTTAATTTGTTAATGTGATTTGCATTTACTATTTGCATTATACAC TGGTAGAATAATGAAAGATGACATTTAGGCAGAATAAGTTAGCTAATAAT TTGGGCTGTGTGTAAATAAATGAAAGACAAATATATATGTATACACACAA ATATATTTTCACATATATACATCAATATTCATACAGACACATGCAGGCTT TTATGCATGCTCTGTGGAAAAGAGCACACACTTTCATTTTGACTACTACA ACACTTGCTCTGGAAATTGTATTTATGTGCTTTTTTAATTTTTTATCACG TCATGGTATTCTTCCTAATTATTACTTCAGCTATGTAGAACATGTCAGTG AGTGCTTACAATCTATTTATATTTTTACTGAAAAATATAGATCTGGACTG GTTAATAGGAAGATAGATACATAAGTTACATACATCTTTGTGTTATTTTC TAATCATTTGCTTAGAAAATATTTATATAAATCACTCCTTTGCTTGAAAT AAATTAGAATTATCTTAATAAGTTTTAAGATTGCTATTTGGAAGTATACT CTTTGCTATTCTAGAAATATAGTCACATATTTTATATGGACTACACATTT GATACCATGAGTATGAAAGCATTTTTTGGTCATGTTGTTGCTTACTTGCT AAGTCACATCCAACTTTTTTGAGGCCCTGTGGACTGTAGCCCACCATGCT TCTCTGTCCATTGGATTTCCCAGTCAAGAATTCTGGAGTGGCCTGCCATT TCCTTTTCCAGGAGATCTTCCTGACCCAAGGATTGAACCTGTTTCTCCTA AATTGCAGATAGATTCTTTACCACTGAGCCACCAGGAAGAACCCTTGTTT GGTACATACAGAGATCAAAATCAGAAAGGAACTATAGAAGTTTGATAATA TAAACCTTTAAGCACATTGTCTAAAGCATAGTATTTTTGTGATTTACATG CTGTTATATCACCATTTAACATAAAATAGTTGATATTCCTTTACAACTCT TTTATTGCTATATCTTATTAGACATTGTTCTTAACAAAATTATCTATACC TGTCTTATCAAAGAAATAGAGGAAAACAAAATTGGAAAGACTAGAGATCT CCTCAAGAAAATTAGAGATCTCATTTCCGTTCAGTCACTCAGTTGTATCA GACTTTTTGTGACCCCATGAATCACAGCATGCCAGGCTTCCCTGTCCATA ACCAACTCCTGGAGTTTACTCAAACTCATGTCCATTGAGTCAGTGATGCC ATCCAACCATCTCATACTCTGTCGTCCCCTTCCCCTCCTGCCCCCAATCC CTCCCAGCATCAGGGTCTTTTCCAGTGAGTCAACTCTTCACATCAGGTGG CCAAAGTATTGGAGTTTCAGCTTCAGCATCAGTCCTTGCAATGAACACCC AGGACTGATCTCCTTTAGGATGGACTGGTTGGATCTCCTTGCAGTCCAAG GGACTCTTGCAGTCCAAGAGTCTTCTCCAACACCACAATTCAAAAGCATC AATATTTCGGTGCTCAGCTTTCTTCATAGACCAACTCTCACATCCATACA TGACTACTGGAAAAACCATAGCCTTGACTAGACAGACCTTTGCTGACAAA GTAATGTCTCTGCTTTTTAATATGCTGTCTAGGTTGGTCATAACTTTCCT TCCAAGGAGTAAGCGTCTTTTAATTTCATGGCTGCAGTGACCATCTTCAG TGATTTTGGAGCCCCCAAAAATAAAGTCTGACACTGTTTCCACTGTTTCC CCATCTATTTATCATGAAGTGATGGGGTCAGATGCCATGAAATTAGTTTT CTGAATGTTGAGCTTTAGGTCAACTTTTTCACTCTTTTCTTTCACTTTCA TCAAGAGGCATTTTAGTTCCTCTTCACTTTCGGCCATAAGAGTGGTGTCA TTTGCATATCTGAGGTTATTGATATTCCTCCTGGCAATCTTGATTTCAGC TTGTGCTTCTTCCAGCCCAATTTTTCTCATGATGTACTCTGCATAAAAGT TAAATAAGCAGGGTGACAATATACAGACTTGACGAACTCCTTTTCCTATT TGGAACCGGTGTGTTGTTCCATGTGCAGTTCTAACTGTTGCTTCCAAGGG AACATTTTATGCAAAGATGAGCTCAATAAAGGACAGAAATGAATGGACCT AACAGAAGCCGAAGGTGTAAGAAGAGGTAATAAGAATACACAGAACTAAA CAAAAAAGATCTTCATGACCCAGATAACCACGATGGTGTGAAAATTCACC TAAAAGCTGCACATCCTGGAGTACAAAGCCAAGTGGGCCTTAGGAAGCAT CACTATGAACAAAGCTAGTGGAGGTAATGGAATTCCAGGTAAGCTGTTTC AAGTCCTAAAAGATGATGTCGTTAAAGATCTATACTCAATATGCTGGCAA ATTTGGAAAACTCAACAATGAAAAGGTCAGTTTTCATTCCAATCCCAAAG AAAGACAATGCCAAAGAATATTCAAACTACCACATAGCTGCACTCATCTC ACATGCTGGCAAAGTAATGCTCAAAATTCTCCAAGGAAGACTTCAACAAT ATGTGAACTTAGAACTTCCAAATGTTCAAGCTGGATTTACAAAAAGCAGA GGAACAGATATCAAATTGCCAGCATCCATCGGATCATATAAAATGCAAGA GAATTCCTGAAAAAAAAAGAAAGAAAAGAAAAAAACTACTTATGCTTTAT TCACTACACCAAAGCCTTTGGCTGTGTGGATCACAATAAACTGGAAAATT CTTCAACTGATGGAAATACCAGACCACCTTACCTGCCTCCTGAGAAATCT ATATGTACATTAAGAAGCAACAGTTAAAAATGGACATGAAACAACAGACT GGTTCCAAATTGGAAAAGGAGTATATCAAGGCTGCATATTGTCAGCCTGC ATATTTAACTTATATGCAGAATACGTGATGAGGATTTCCTGTCTGGATGA AGCACAAGGTGGAATCAGGATTGCTGGGAGAACTGTCAATAACCTCAAAT ATGCAGATGACATCACCCTTATGGCAGAAAACAAATAGAAATTAAAGAGC CTCTTGATGAAAGTGAAAGTGGACACTGAAAAAGTTGGCTTAAAAGTCAC GTGTACCCCAGTGTTCATCGCAGCACTGTTTATAATAGCCAGGACATGGA AGCAACCTAGATGTCCATCAGCAGATGAATGGATAAGAAAGCTATGGTAC ATATACACAATGGAGTACTACTCAGCCATTAAAAAGAATACATTTGAATC AGTTCTAATGAGGTGGATGAAACTGGAGCCTATTATACAGAGTGAAGTAA GCCAGAAGGAAAAACATAAATACATTATACTAATGCATATATATGGAATT TAGAAAGATGGTAACAATAACCCTGTGTACGAGACAGCAAAAGAGACACA

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnt.fa (2013-03-31)
    Open archived version from archive


  • AGTGGAGAAAGACTTACGCGTTTGTTCCCTAAAAGCATACTACAAAATAA GCACTGTATACACCACATGAAAATCTTATCTCGCCCTCAGCAAAGACTAT TTTAAAGATTTCAATACAGGAATCTAATTCCCTTTTATTTCTACTGATAA CATATTACAGTAAATCAGTAGCTAGACATTTAAGAGTTGAGAACCAGTAG ATGGCAGTAGCAAACTACAAAACACTTTTTGGTAAGTTGTGCTAAAGCAT AAGTCCTCATGAAAATTACGTATTTCTACATATGTACTTATATTTTATTT TATATTCTGGTCTATAAAACTGGTCAGTTATGCTTCTAATGAATTTTTAC CAAGCAATACCCCTGCGAGGGCCCAATACATTTAACCACAATTAGGATTT ATAGATCTTCAACATTTTAGCACAGTTGCTTATCAAGTCCACTAGCACTT TAAGTCTTTAGAATGCAGAGCAGTCAAAAGACACATATACTGGTGCTAAT TTTGGATAAATGTTTAATAATAATCCAGAAAAGATGGAATCAAAGGTTTC TGGAAGGCTTTTTTTATCGAAAAAGAATATTAAACAGGCAATTAGAATTT TCTCCACTATAAATGTAGATGGTTTGTAAGCATGGGAAAGCTTTTCCATG TCCTTATAAGAGAGCCCACCATCTTCAATGAACATGAGATAATACGCTGC CCTAGTATTAAACCTCTGGATACAAATAATTTTCCTTACCACATCAGTTT TGCTTAGTAGTGGCAAAAAACAAAACAAACAAACAAAAAAAACTAAAGCT TTACTATCTGTACAAACATAAAATGTTCCAACTCTCTTCATGGTTGAAAT TCGTTCTAATTTCTCCTTTTGAACTCGTGTATAACTACAGGGTTAATAAA AGTTCTCTTGTTTCTGGTTGTAAAACTAATCACACACATATGCATATATA TACACATACACACACACACATAGGAAAAAAAAAACTCAACTCAGTTTAGC TCTATATGTTGTTATGTTAGCACAAAGTATTTAATATGGAGACTACAGAG TGAGATATTCAAAAAAGTATAAGGCAGGGACATTTTCTCAAGGAGTAAAA TCCTTTATAGTGAAGTGATAAAGAACAGGTTTGATAATCATTATGCATGA TGTTAATACACAGATTTGTAACAAATTTGGTCGGCATATTAATTCCAAAG TGCCAGACTAGAGAGAAGATACAACTATTGTGGGGTAGCAACACTTTTGC TAAGAAAGCATTTCCCAAACCTTGGCAAACATTTTGCTCCAAGAACTCTA GCAGCATTTGGAATACCTAAAAGGCAAAACAAAAGCACATCTGAGACAGG AGCTGCCAGGCCTTGAGTTCAGTATTATCACCTCTCCTCTGCTGCTGAAT CACCTTAAGATGCAGACACTGTCCGTCAGATGACAAATTTAACTGACGAA GCTTGTAAAATATTTATTAAAAGAGCTTAGCAAACAAGTAAGCTTTCTGC AGCTTACAATCTTTATTATGAGACAGCAGAGCGCCACAGGACACTCTCAG CAAGGAAAAACAGTACCATAATCATTAGACTTTTTAGTGTTACTATGAGC TAGCACATCAGGATGGCACTTCTATTTCCTGTAAGAATGGTTAGCATCCC TTTACACAAGCTTTGTTTCTTGAATCACTCATTGGTGATCATAAGAAACC CACAGTGCAGTGTGTGGGGAATCATATGACGGCATGAGTGGTCAGTCGTG TCTTGACTCTTAGCAACCCTATGGACTGTAGCCTGCCAGGCTCCTCTGTC CAGGGGAGTTTACAGGCAAGAATACGGCAGTGGGTTGTCACTTCCTCTGC CAGGGGTCATATGACCATTCCAATAAAAAAATAAGCTTACCTTTCCATGC CAAAAAACACTGAAAAGCAATAAGGACTTCTATTTCTTTTTGTTTGTTGT CTGTCATGTTACTATCTATTGATAACATTTACTCAAAGATTCTGTGATGT TGGCCAAGCATTTAACAGAGGAATCTATGGACTAACTGTTGGGATATTTT CTCAGAGAGAAGCCTGATGAATCTCTGCAATTTTCATTAAATTTTTCCCA GTCTTTAAAATAAAAAATGAATAAATCTTAATTACATGTAATGTAACACC TGACAATAATTTTTCTGCTAAAAATTAAGGGCTGACTTTAAGCTTTGGGT GCCCACATTCCCTCAAAGATATCACCCCAATAAAAAAGCTCCCCAACAAA AAAGGGGGATGGCCGGCCCTCCTCCTAAAAGGCCCGGGGGGAACTAATAA ATGGACCCCTTGAGCCCCCGGAAACCTTTCCCTCCCCAGGCTTTAAATTC TTGGGTTTTTTGGTTTAAAATTCCCAAAAA project fbnu AK 20040903 5651bp CCCCCTTCTTTTTCCCCCCCCTCCCCCCTTTTGTTGGGGGGGGGTGGGAA GAAAAGTTTTTTTTTTTTTTTGGGGGGCGACGGGGGGTTGGGTTCCCCCC ATTTCCCCCCCCCCCCTTTTTTTTTGGGAAACCGGGGAAAAATTTTTGTT TTTTTTTAACCCTTATTTTTTTTTTTTTAAAATGGGGAAAAAACCTTAAA GGTGTGCCAAGATTAAAAGCTTTTTTTCAAGGGATTCGGGTCAATATAAG CATTCAGTAATATTAGCAATTAGGGGTTGGTTTTTTTTCTCCCTCTTTCA TTCGGTGTCTCTCCAGTCTCTTCTTTTCTCCTTTTGTTCTTTTTTTCAAA TCTTCAGTTCTGAGATGTCCCCCACGAGTGAACACTGAGAAGAATTGATT GTATGGGGGTGGGGAGGAATGCTTCAGCTGGCCCAGGTGAACACATGATG ATCAGATGATTGATTATCTCTTCATTGTCTGTCCCCACCCACAAATGTGT TTTGTTCCAGGGAAGACACATGATCTGTTTCTCTTTCAGCCCCCTTTCCT ATATCGTTTTCTCACACAAATTTCTTCTTCAGAGTCTCACCCAGAAGTGT AATAAGACTCAAAGTTATATAGGCACTGCATCAAGTGAGATAGGGGCAGG GGTGTTTCAGGAAAGAAAATATGCAGGTTGCACAGGGGAGACTCAAGGAA AGGAGGGCTTTGAATTTTTCACAGTAATTTATGTTCATACCGTTGCTCTC TCCTCTGTGGAAACTGTCCAAAACAGGCTAGTGTCTGGATCCTGGCCAGG AGTCTCCGTCCCGTTAAAGATGGTCATATAGAGTTAGTTTTTTTTAATTG TTTAGGTTTTCCCATGCTAGTATTTGATTCTAGTTCACTTTCCCCAGACA CACAGACCTCTGCCAAACTGCCTCTCTCTCCATCACAGTCAGCTTTTACC CAAAGAGTTTATACAGATGTACCTGGGCACATACACACACATTTGTCTGT TTTAGGATATTCCAGTATGCAAAAATAAGGTTAGGGATGAGTCTGCATTT TGTCACAACACTTTGTATACAGGGCCCTGACTTGACATTCAGAAGAGACT TAAAAGGAGAAAACTCAATCCCTAAACGTGGGGAAACCCCGACCTGAGTA GCAAGACATGCAGTCCCATGTGGAACACCCAGCAGACATCCATAGAGTAG CATGTGACTCTGTGCAAAGTAGTTCAGTATTTATCCCGAGGAGACTGAGG TAGGAGGGTGTATATGTGGAGGATAATCATAAAGGCCCAAAAGGAGGTGA ATATCGGATCATCTTGAACAAAATAAGAGACAAAGCAGAATAAAAGAAAC ACATCTTAGTAATCTAATACTTTCTGTGCAAAGAGGAGGAGGGAAGCCAT GAATCAGGGTGAGCCAGAAGAATGTGGGATGGGTCTTGTTTAAAGGCTTT GAATGTCCGATGAAAGATTCTGTAGGGTGGGCAACGGGGAGCCACCACTG GTCTCCTAGCAAGAAAATGTTGGACTTCCTGGTTTAACCACGTGGGTCAC AGAGAATATGCTAGAGTGAAAAAAAACAGAGCTCCTTCTTGTAAGGATTG TGTTTTTAAGGGAGTAGGCCTGGAGGGCAGATTGAATCCCGTCCTGGGAC CCATTATTCCCCCCTTTTTCATCTGAGAAAAAATGCCTAGGGTAGTTGCC AGAGTCTCCTCCAGCTCTGACATTCAGTGTTCCCTAAATAACTGCTAGAC CTTACTGATGGCTTTGTTTTGTGAACCTGCCAAGACCATTCAGTCATTAA GTTAAGAAATAATAGCATGTACTGTGAGCCAGTGGTGGTGGTGGTGAAAT TACAATGGGCAAAGGGTTCTGGGATGAGCAAAAACAAAGTCCTTGCCCCT TAAAATTTCTAGCCTAGGCTGGAAACTGGAGGTATCACATATTTCATTGA TTCTGAGACTCACATCTTAACATTTCTGAAGTCAAGATGTGTCTTAAGAT CAGTGGTGAAAGTTGCTCAGTCATGCCCAACTCTGCGACCCTGTGGACAG TAGCCTACCAAGCTCCTCTGTCCATGGGATTCTCCAGGCAAGAATACTGG AGTGGATTGCCATGCCCTTCTCCAGGGCCCTTTGCAACCCAGGGATCAAA CCTGGGTCTCCCGCATTACAGGCCAGATTCTTTACTGTCTGAGCCACCAG GGAAGCCCAAAATCAGTGGAGTATTGTAATTTGGGCAGCATTTGTTTTTT ATTAGTGCCACATAATAATACAATCAGATACAAACTGATACAATTTGTAT CAGTTGTACAAATAACTAAAATTCCAGTGACTAATTGCTGAAGGGGAAGG TACATGGTGTATGAGAGTGTAAAAGAGGGCTCTGACTAGTCCGCTGGGTT GGAGAAAGCCTTTCCTGAAGAAATGATGATGACCAGATCTAAAGGTTATG GAGGCGGGGTGTGTGGAGTTGGAGGGAGCATCGCCCCAGGCAGAGGTGGG TGTCTTAGTTGGGAGGACTGCAAGAAGGAGCTCAACATGGGTGAGGAAGA TAAGGCAGCTGGGAAGCAAACCTGCCACAGCCTCCCAGGCCCTGGAAGTG GGTTTGGGGACAGTGGGAAGCAATTAAAGAGTTTTAAGCAGAGGAGTAAT GTAGCCTGCGGTTGGAGTGGATGTGGGGAGACCAGTCAGGAGGCCACTGA AGTAGGTCAGATTTTTTTTTTTAAGTTGTAGGGTTGGAAAAGGAAACAGA AATAGATGGATTCGGGAAATCTTTAGGAAGTAAAATTAACTGGACTCATT GATGTATTCACAAGAAAGAGGGAGGTGTGGTGAGTGGCTCACAAATTTCT ATCTTGGACAACTGTGTGGATGGTGGCATAGTCTCTGAGATGGGTAATCG TAGAGCCTGGTAGGACCCAGAGATGGTTATGTAGCCTCTGGGAGGCTGGG ACCCTGAGGCAGGTTGGGTGGGAAAGTGTGGCACAGAGAGCTGGATTTCA TCCTGAGTTGATTTGTTTCTGACTTCTAGTGCAAAAGGAGGTTTCAGGGG GCGGAGCAGGTCTGAATTCAGGGCTTAGAGTAGCTGAACCTCAAGAAAAG GTAATTTAAGTCGGAGTAGTTTGACTTACCCCCTCTCTTAGGACAAGATA AGCAGAGGGAAGGAAGGACAGGTGTTGCTGAAGTAGAGAGTAGAAGCATT GTTAAATACTGAGTCTTCCCAACATAGGGATAATTGGGAAAGTCGGGAAA TTGGGTGGCAGTGAGCCAGCTCCCACCTTTACCTGGATCTCCTCCTCACC ACCATACTCCAGCACCTTCCAAGCAAGGAGGAAGGACAGAGCCTTTTAGC TGCATTTAAGTGCCCCAGGTTACTTAAAAACTGTTTTTGAATGGGTGAAT CTAGCTATATTCAAAGTTACAGAGGGCAGATAGAGTTCTTTCTACCAGTG TCCTCATTCTCATTTCTTGTGTCATCTTTTGTTTCTGATTTTTATGCAAG TAATAAAACTTTGCTGCACTTTGCTTTTTTTCCCACTTGTTTATGTATCT TCCAGATTATAATCGAGACAGTGAGCCTCTTCATTCTTTTTATGACTGCA TAGTAGTTCATCTTATGTTTGTGTAAAATTTTATAGTTCCTTACAGATAT TTAGGCTGATTACAGTCTTCTGGTTTTATAAATAATGCTGCTCTGAAAAT CTCGTACACACATGTAGGGCTATATCTATAGGATGAATTTTTAGAGCCAT AAGATTCTATATAAATAGGATTTGTTCCTTCATTTGTTTATTCATTCACT TTATATATGTTGAGTACCTATTATGTGCCAGATGCTGTGGCAGGTACCAG GAATTCAGCTTTCAACAACTCAGATATGATCTCTGCCCCCATGGAATATG TGTAAGGGGAAGCACATATCCAGTCTAACATAATAATTACACAATTGTAT ACGTGAGGGAACTAAAAAGAGGATCAGAACAAATTGGACGTGCTTTAAAT AGAGTCAGGAAGGCTTCTTAGAGCAAGTGATATTTAAGCTGAGAACTAAA GGATGAGATGTGGCTAGCCATTGGGTGTGGGACAGGGAGACCTAGGCTGT TCCAAGCCTCCTCCACTGGGATGAACCTAGAAGAGGCACAGGCTGCTGTC TTGATGGGGGCTGGGATGCAGAGCTAAAGAGGAGGGGATGGGAATGGAGC TGTCAAGGACAGTGAGTGACTAAAGATGAGGCCAGTTAGGGGAGGAGGCT GGTGGTAGTACTTAGGAAGGACTAATTGTGTTTAGAGGGCTTTGGGTTGA GTCTCTGTACTGGGTGAATTCAGGAAGGTGAACAGGAAAAGAGGCCACTT CCTTCCTGAATGGGAATGAGAGACCTCTGACTGACTGGAGGGAAGCGCAG CCTTGCCCACAGGCGGGAGGGTGGATGAAAAGCCTTGGAAAGAGTTGATC TGTCCCTGTAGTAGAACCTCCTCCATCTTTTCATGGCTTGGGCAAAATGG AAACTTCCAAACTACAGATGACTTTAATGGGGCTCAGCCAGCTGACTCTG GACTGGCAAAAGAACAGATCTATCGAGGGCTCAGAGTGGGAATGGGTAGG AAACTGGGCTTTGAGACTCTTCCTTTGAACTTTGTGCTCCTTTTTCATCC TCACCCCTCTGCTTCTCTTCTACAAAAGCCCATCTCTGCCCATCCGGGGT TCTATGACTTTTCTCTCCCTCAACAGTCGGTTCCCGATTCTGGTCCCCGG CCCCCAGCAGCGCCTGCCCCCTTCCCACCGGGGCCCCCCATGATGCCACC ACCCTTCGTAAGTTTTATGTCTTTCCCTGGGCTTGGCTTTTCCAGCCTGC ATCCCCAACTTCCTAGCCCCCAGCACTGCTGCATCGCCAGCACAGTTTTT GTGTAATGCCCCCTTCCTGTTGCCCTTGGTTGAGGGATGGTTTTGCTTGG GTCCCTAACGTTGACAGTTCTCCCTTTGCTTTTATGTCCTTGGTACTCAC GGGGTCTGGGGGAACATACGAACGAGATATTACCGTTTTGGATGAAGTAT GTAGATTATTCTGAATTTTTTTATTATGTATATCCGGTAGAATTTTACTC CTCTATCTACCTCAATACTCACAGGCCCCCGCATTTATCTTCTTTATTCC TTTACTTTATTGCTTTTAATTTCTTTTTCTCCTTATCTATACCTCTCGAA TAATCATCCCTCTTCACCCCTACCTCTTCTAATCTCTTTCTGACCTCACA TCTTCATTACTTCTATTCAACATATCTTTCTCCCTCTCCAATTTTACTAC CATTATTATAGAACATTTTTATTTCTAACTCCCCTCTCCTATTTAATATA TGTTAATTTTTCTTTTTTTAAATCTGCCATATTCTTCCCTCAACCCTTTC TCCACATCTTTCACCCTTCTCCACCTCCTTCCCTCTACCATTACTCCATT TTTTCTTTTCCTTTCTATATCTCTAAATTCCTTTTTCTTTTATTTCTATA TTTTCTTCTTCCCTTTTCTTCTCCTCTATTTACTTATTCTTTTATTCCTC TTTCATTCATACTCTACTTTCCGATCTCTTTTCTCAACATATTCCTTTTT CATTTTCCTTCACCCTTCCCTTAATCTCCGCTTCTTTCCTTCTTCTTCAT T project fbnu AL 20040903 4619bp TAATGCAGTAGTTCTCATCCTGGGGTTGCAAAGAGTCGGACACGACTGAG CGACTTCACTTACTATGGAACTAGAGCCCACACACAGCAACTAAGACCCA GTACATTCAAATAAATAAATAATTTTTTTTTTAAATCAGCTTTATTGACG TATAGTTTACCCATAATAAAGTTCACCAATTTGAAGTGTAGGGTGCAGTG AATTAATCATGACATAAAACAGTTCCTTCCCTCAGAGACCTTCTTTGTTC CATTTTGCAGTCAGTTGAATCTCCCTCATCTGGCTCCTGGCATCAACTAA CCTCCTTTCTGTCACAGCAGTTTTACATTTCTAGAATTTCATAAAAGTGG AGTGTATAGTTTGTAGTAGTTTGTGTCTGCCCTTCTTTCGCTTGGTATGA AGCTTTTGAGATTATCCATGTTGTTGCATGTATCAGTAGTTCATTCTTTT TTAAAAATACAGAGTGGTACATTTCATTGTTTATCCATTTACCAGTTGAT GGACATTTAGATTGTTTATAGTTTTGAGCTATAACAAATAGAGCTGTTTA TGAATATTTGTGTATAGGTCTTTGTATGGATATGTTTTAATTTCTCTTGG GTGAATACTTAGGAATGGGCTTGCTGCATTGTATGGAATAGATATTTAAT TTTTTTTTTTAAACTGCCAAGCAGCTTTCTAAGTGGCCATACCATTTTAC ATGCTCACCTGTAATAAACGAGGATTTCACATGCCAACATCCTCCTCAAC ACTTGGTGTGTTCACGCTTTTTATTGTGGCTAACAAGTTGTGATTTTATG TGTATTTCCCTAATGACTAATGATGTTGAGAATCTTTTTATTGCCTACTT ACCTTTTGAGAACCTTCTCTTTTTTTAAGATTTATTTATGTATTTTTGGC TGTGCTGGGTCTTGTGCTACATGCAGCAAGAGGGGGACTACTCGGCTGTG GTGCGGGCTTCTCACTGGGGATGGCTTCTCTCTGTGTGGACTTCAGCAGT TGTGGTTCCCGGGCTCTGGAGCACAGGCTCAGTAGTTGTGGCCACAGGCT TAGTTACCCCTTGGCCTGTGGGATCTTCCTAGACCAGGGATCAGACCGTA TCCTCTGCATTGGCAGGCGAATTCTTAACCACTGGACCACCAGGGAAGCC CGTGAATATCTTCAGTGATGTGTCTATTCACATCTTCTACCCATTTAACA ACTGGATTGTTTTCCTTTTTGTAATTGAGTCATAGTGGTTCTTTATATAT TCTGAATACAAGTCCTTTATCAAATACATGTTTTGCAAATAATTTTTTTC CTGTCAAGGGCTTCTATTTTCTTTTCTTTTATGTCTATATCAGGTCTGTG CTTTTATAATATTCTGTCTTGTTTTTTGTAGCAAGACAATGCTAACTGCA TAAAATGATTTGAGAAGTATTCCGTTACTGTTCAACTTTCTCAAATAGTG TATATAGAATTGTATTATGTTTTCCTTAAATCTTTGGCAAAATTTACCAA TGAAGTTATCTGGGGCTGGAGTCTTCCTTAAGGGAAAGGTTTTTAATTAC AATTTCTTTAGTAGATACAGGGTTTTTCAGGGTTTTGCTTTCTTATTGAG CTTTAATAGGTTGTATCCTTCAAGGAATTTGCCTATTTCATCTAATTTAT CAAGTTTATTGGCATAAAGTTTTTTCATAATACTCTCATTATTTCCCACT ATAGAGTCTGTAGTGATGTCCCCTTTATTATTCCTGATGTTGGTAAATTG TGTCTTTTTCCCCCCCTGATGAAAGCTGGATAGAGCTTTATCAATTTATT AATCTTTTCAAAGAACCAGATTTGGGTGATTGCACTGATTTTCTCTATCT TTGTTTGTTTGTTTTATTTATTTACTCTTATCCATACGATTCCCTTCTGC TTCAGTTTCTCTGTAATTACTTATCTAGTTTCTTACTCTAAGCACTACTT TAGCAGCATCCTATAAATTTTAATATGTCAATTTTTCATTTTCACTCAGT TCAAAATACTTCATAGTTCTCCTTGTCATTTCTTCTTTGATTCATGAGTT GTATAGAAGTATGTTGTTTAATTTGCAAACATTTGGGAATTTTCCCACAT ACCTCTTAATTATTGGCTTATGGTTTAATTCCATTGTGATCTGAGAACAG ATTTTGTATGATTCTAATCTTAAGCTTATTGATATTTGTTTTATGGTCCA GATTATTATTCCATATGCATTTGGAAATAAGGCATCCTGCTGTTGTTTGG TGGTGTGTTCTATAAATGTCAATTGAGCCAAGTTGGTTGACAGTATTTTT GAAAACTTCTGTATCCTTGCTTTTTTTTTTCTCTACTTTTTCCAGTTGCT GAAAGAAAAGCGTTGAAGTCTCTAACAGAAATTGTGGATTTATCCATTTC TCCTTTCACTTCTGTAAGTTTTTTGCTTCATGTATTTTGAAGCTGTTATT AGGTTCAAATATATATAGGATTACATCACTTTTATTAGTTGACACCTCTA TCATGGAGTTTATGGATTTAAAAAGGACACCTCCCTTTTTAACTTTGCTA ATCTTTCTTGTTCTAAAATCTGAAATTGGGACTTCCCTGGCGGTCCAAGT TTCCAATGTAGCAGGTGCTAGTTTAATCCCTGGTCAGGGAAATAAGATCC CACATGCCGTGCCATGTGGCCAAAAAGTAAAAAATAAAATAAAATCTGAA ATTGATGTAGTCACTCTAGCTTTCCTTTGACTAGTATTGGCATAGTTTAT TTCTTTCCATCTTTTAACCAATGTGTGTCTTTTTATTTAAAGTGTGTTTC CTGTAGACAGAACATAGTTTGAGTCTTGGGTTTTTCTTAATTGAATCTTA TAATCTATCTTTTAATTAGCTTATTTAGATCATCTATTTAATGGCACCCC ACTCCAGTACTCTTGCCTGGAAAATCCCAAGGACGGAGGAGCCTGGTAGG CTGCAGTCCATGGGGTCTCGAAGAGTCGGACATGACTGAGCGACTTCACT TTCACTTTTCACTTTCATGCATTGGAGAAGGAAATGGCAACCCACTCCAG TATTCTTGCCTGGAGAATCCGAGGGACGGGGTAGTCTGGTGGGCTGCCGT CTACGGGGTCGCACAGAGTCAGACACGACTGAAGTGACTTAGCAGTAGCA GCAGTAGCATGATCATCTTCAAGAGAAAGAAAAAGTAGAGAGGGAGAGAA AGGAAAAAAGAGGAAGGGACCCCAGACGGGGAATCAAAAAAGCAGGTTGA AGTCCTGATTCTGTACTTGCTAGCCCTGTAACTTTAGATAAATCTCATAA CTCTGAGCCTCAGCTGGCTCTCAAACATGTTTGTAAGGATGAATAAGTTA TTTGTAAACTACAACATGCTCTGAAATCACAAGGGATTAAAGGAATCCAG TGCCAGATGTATGGATAGGAATCCATAAAGCAGGATGTGAGTACCTCAAA GGCAGAACTAGGTCTCACTCTTCTGTATTTCTAGCACCTAGCTTCATGCC TGAAACATTCAAATGTGACCAATAAGTGTTCATTGCAGGAGTGAGACAAT GAAAGAATTAACTTTGAATAAGCTTGAGCCATAGGAGAAGCCCATAGTGA AGGAATGATAGTATGTAAAAGACGGGTGGGTGTCAGGTGGCATGTTTTTA AGTGAGTATCGTCATGCTTGAAAACTGGACTTATAATGGTGAATTTTGTA ACTGCCGGAGGATGTCTGAGCAATGTATAATCAATGGGAAGGGAACGGCC TCTTCGGATAGATGATTTGAGAATGCGTGAGTTTGTTGACTATAAATTAT ATGCTAAATTCGCTCTATTCTCGCTGTTAGAGTCAGGCAAGAGTCTGGTG GCTATTTTTTCTATTGTTGTAAAACTGGTGAGGATGCGGACCAGGAGATC CCAGGGTCTGCTTTCGCGTTTTTGATTATTTTTTTGATTCATTTTGTCTT TGGGACGCGCCTAGGGCCCGTTATATAATATGACGCGCCCCCTCCGCGCG CCCCCCCCACGTACTCCCANCCAGAATTGAACCGGGAGGGGGAGTCAATG CTTTAGTGACACGAGGGACTGTGGGGGTGGAGGACGAAGGAGAGGGGGGA TAGACTGCGTATCGTCTTGCTCTGTTCTTCATTCTTGGTGAGTGATCTTG TTTGCTAAGAAGATGGGTGGAGGGAATGGAGGAGAGTGTGGGGTTCACGC GGGCAATGTCTGCCTCTTCGGCCGGCTCTCCCCGCCGTCCCCGCACCCGC TGCGTTCGCNCGCCGGCCGTCCACCACACAAACGCGCCCCAATACTCATC TCTGATATAATAGCTCCTCCTACAACTACATACTATAGANACTAGCGAGA TATGTAGATGGACGCTTACGCGCACAATGAGCTTGCTCCTAGCTTCGTCG ATCCTACCCTACCCCACCCCCCTTCACCCCTACCACACTGCGTGCCCTCC CGTGTCATCTGATATAGAACATCCTTGCCCCGTACCTAATTGTGTATGAC CTCGTGTACATATTATAGTGATCTACGAACATATCGTTGCTTGTCGCTTG TTGTATGATCTATACTCACTGTACCTACTTGTTTTTGTGAAGGTTGTTGT TGACTGTGACTGTTGTGTA project fbnu AM 20040903 4386bp GGGGCATGATGGTACGTAGTTCTCAGGGTGAAGCGGCAGCTGAACTTCAC ACCCAGGTGGACAGATGTCACGTCATTGGTCTGCAAGACCCCAGAGCAGT TTGTTCCAGCTTTTGAACTGGGAAATACCCTCCCATGCCACCTCCAGACA CTGCCAGGCTAGCTGGGGGCTGAGAACTGGCAGCAGTGGGGAAAAGGGAA CAAGACCCCTGTGGTAGGAAGCACTACCTGCAGCACGGCACTGATGAGCA GGAGGTCGTCCGCAGGCTTCCAGCGGCCCAGGTCCTTGGTCACCTGCAGC GGCTGTTTGCTCTTCTTCACACGCTTGGTGAGTCCAGGGGCTGGGGCAGG GCTGGGTGGCACCGGTGTGCTGGGGGTCTTGGACACCTGGGCAGAGGGCA GGAGTAGAGTGAGCTCAGAGCTGGCACCAGGGCAGCTGGGGTTTCAGACC CAGAGCTTTGTACAGCCCCACCCAACAAGAAGCCACAGGCAGGGAGCTCA GCTTTCTAATACCAGCCCCTCCCCGTTCCCGCCCCCATCAAAGTACTTCT ACACAGTCCTAGACCATATGGGGTCTTCTTTTTGGTGATGGTGCCCCCAG CCCCGGTGTGGAGGGTGGGTGGGGAGGATACCAGGAAAACACTCTTGCTG GTACAGTGTCTGGGGCCAGAGCAATGCCACCTGGGGGTTATTTTTACACC CAGCAATGCTGGGAACAGGCTGTCTGCTCCCAGAATAGATGCACGCTCTA TGCCTCCCACACAGAATGTGATACAGGATGCGCTGACAGGGTGGTGGTGG TGGGGGGTATGCAGCAAGAAAGCGGGAGTAGTGAGATGGGCTCCCAGGAG GGAGGCATCTAAGGTTGGGGCTGGGGCGGCTTGATCCTCTCACAAGCCTC CTCTGCAGGGCTCTTGCCAGCTGGCGGAGGTTGTGGGGAAACACGAAATC TGGCACTGGCCCCCACCCCCTGCTACTCCCCATTCTCCCAATCCTCACCT TCTTCTTCTCACTGGAGGAAGGTTCGCTCCCCGAACAGCGCCCTGGTTCC ACCCCACTGGCCCCCTTCGCCCGGGTAGAGGACTTAGCCAGGCTGCTCTC CACCAGCTCATCATCGAACTTCTTCCTCTTGATGAACCTGTGAAGAGTGA ACCTACTCAGTGAGCTCTCCACGCCCCACCCCCAGTACCCACTCACCCAC ACCCAGCCTCCAAAGAAGAGCAGGTTCCCAGCAGTCAGAGTGCTCACTGC TCTGGCTCAGTGGTCGAGGCATGGAACCTCTATGCTCCACCCCTCTGAGA TGACAGGGTACCACACTACAAAGACTTCACATCAAAGACCTAAGATCTCC CTCCCTTGGTCAGTCTCAAGGAGATACTCAGTAAGGTCAGGAAAAGCACA AGCCTCTGCCAACGCAGGCCCCAGAGGGGTGCAGGGGTGAAGGCATGCTG CAGTCTCAGTTTCTGGCCCTTCAAATCCTTATTACCTAGAGGAGCTTCTC CGTTTAGGGATGGTTCCCAAGGCCTGAGAGGAGGCCCGCTTCTGCCCTGC CAGTGACTCCTCATCCTCTGAGCGGCTGGCAGTGCCCGATGCCATGAGGG ATGAATCTAGCAGCCCCTGAGAATCTAGAAAAAAGAGAAGTGGTGAAGTC AGAGCTCCTAATTGCCAAGCAGAGCCTTGAGCCTCTGCACAGGGGACCCC TCCTCAGCCCCCCTTTCCCAGCCAGCCCTCTTGGTCCCTCCCCTGCCTCC TTCACATTTGAGGTTTTAAGGTGGGAGTTCCTTGGCCATCCAGTCCCATC TGGGCCCAGACCTTCCACGCTGGGCAGTTCTCCCGGTGCCACGTGTCATG TCGTGCAGCACATGGTGCTCAGGTCAGACTGGTGATGCCGACACACCGGG CTCTGGGCATAACTGCTCCCTCTGCCATCAAAATGCAGCCATGCCAAAGA GCAGCAGCTCAACAGAAAGTCAGTCAACTGTGGCCTCTGCCGAGAGGTAC GTGGGTGGTGCTGGCCCAGGGGGAGGTGGCAATGCCCAGCCAGGACCGAA AGACACACGTGCCAGGCACGGGGTGGAATCAGCAGATGCTTGGCGCCTGA GCGTTTGGGGAGCTGGCCCGGCCTCATACTACCTTTGTCCATCCTCTTAC AGTCCCAAAGCCACTGGTTCCAAACCACAGGGCTAGAAGGAAGGGTCCCA CAGGCTCATCCAAGGATTCTGACCAGGTGAGCTTAGAGGCCGAGAGGAGA TTCTGCAAAGGAGAAATGAGGCTCCCTGAGGCTCAGATTTCCATCTGGCC AGCCTCACCTCCTTATACTGGAACTGGTCCTCAGCATCCCATAAGCTAGC AAAAACACCAGAAAAGACACAATATATTCTGCCAATATGACCCTAATAAA CCAGTAGCCTTTTGAAGGTCACCAACATCTCTGAGACAGTGATAAAAGCT AGGGACCCTAGAAAAATGTACACATTTCAGGAAGTTCACAAACCCCTCTA ATTCTACTAACAGCCCCTAGGTGAAGGGCCTTGACTCCAAACTAGCAAGA AACAAAAGATTCTTGGCTCACTTTTGCTTTGTCAGCTGCCCACTCAGCTC CCCTCCCAGTCCAAAGCACGGGAAAGGAAAAGGAGATAGGACTCCAACCA GTCTACCTTTTTTTTTTTTCATTTGAAGCTTTGGGTAAAGATTTAGAGGG CGTTACTTCGTGGAAGTTGAAAAACGCGGCTTGGTCACTGAGCAAACATC AACCGCCGTCTGGGGGACCCTCGCCTAAGACCCGGAGAACTCAGGTGCTG GGGACTATCCGGTCCTGCCCCTCCTGATCAGGGACGCTTCTGACCAGGAA GCGCTCGTCAAACCGCTCCATCGGATACGGTTGGGAGTTCAGCCACTTGG GGAAAGGGTGAATAGCCCGATGCCGCCGTTACACTGAGGCAGGGTCTGCG TCCCCTTCCTTCTCTGGCCCTCCGCCCTTCGTTCTCCCCGCCAAATGCAC ACCCAAAGTAGGGAATTTGTCCGGGTCTGTTTCAGGGGCTCGGGATACAA GTGGTGAAGTCAGTACTGCAACTCAAAAGCAAAGCGCCGAATGAACCCTG ATGCTCTCGGAGCCTTGATTCAAGCCCCAGGGGCCGGTGGCGGGGGAAGG GAGTCAACTCCCAGGCTAATTCTCACCCCACCTTTGGCATGCTACCTTTG CGCATGCGTAATTTCTCGGACCAGATTCTGGCCCAGTCCGGCCCACGCAT GCGCAGATTTTCGGGGCGCTACCGGGGCGGGGCCCCAAACCTGGGGGGAT CGTACCCGGCAGCATTCTGGGAAACCCCATTTCACCCCCAACTCTCCTCA GAATCCTCAAAGGCGAACCGCGAAGTCTCACCATTCCTAGGCTGCCAGTT CCAACACTTTCTCCGCGGCGACGGCAGCAGCCGCAGGGCCAAGGCCGGCT TCCGTGAGGTTCGTCTACTTCCGGGTCTACGAACTAAGGGTTGAGCAATC CCTTCCGGTTCGCCCCGACTACGTTAAGTAAAGGGGCGTGGCCATGGTAC CGACGATATTACCGTTTTGTGTATCAGCAGAAGTTAAAGTCTTTCCTAAT TGAAACACCTTATTGGGAGACATCAGGTATTATAGGCCCCAAGTTGGAGG AAGTGATTAAAGGGAAAGGCGAGAGTTGGAGCGGGATAGCCTGAGCAGCT AGGTGAGGCAATCTTGGGAGAGGGTGGGCCGGAGGGTGGGGCCGCACAGC TACTAGATTTCGGCTTCCGAATTTTGCCGCCTTGCTAGAGATCTAGGATT CTGATAGTTTCCCAGGAGCACTTATAGATTGTTTGATTCCACCAGCGGTT TTAGAGAAACTACTCTGTGGCAGGCCTGTGCTAGGCACAATATGAGGAGA CGATGTTGAGGAGCTCCCTCCAGCCGGAGAGATGTGGCGTATAGAAGGGG CCGGGAGGTTGATGTCTAACGAAAGGATGGAGAGTTGTGGACCGCGGCTC TAGAAAGCAGAGGCCAAAGAGAGAGAGAGAGAAAGAGAGTAAAGGCCCTG GGAGAAGAAGTGCCCATCCAGTCGGCCCCACCACGCCTGGATTGCTGGAG GGAGCTGTTGGCCCTGGGAGGTAAGACGACCCGCGGAAGCACCTTCAGAG GAGAAGCCCTGAAGATGGGAGGACAAGCCTACAGGAAAAGTTGGGCGTTT GAGGGTGTGAGAGGTGCCTTGAGAAACCAAAAAGACTGTCCTCTAAAAGA GAGTTTCTATTTGTTTCATGCTCACTTGGAGGGACACAGAAGTGTAATAG CTCTAAAGAAACATACTGCAGCTCAGAATAAGAAAAGTACAATTCCAAAG CTGTCTAGCAGCTTGATAACTACTGCATCAACCCCC project fbnu AN 20040903 4365bp AACAACAACCCACCCCACAAAAAAAAGATATAAAAAAAAAAAAAAAACCA CACCCTCATGTTGGTAGTGGTTTATTGTGGTTTATATAATGTAGTCTCCC AATATATTATGTCTTTCTTGAAAAGAAAGAGGAGGGGCGTGTGGAAGAGG GGTATTTAATCTGGCCCACAATATTTTTTTTGAACCACATTTCCCTTTTC CCGCCCCCGGGGGGGAGAGGAGAAGAGGGAGAACCAAGAGAAAAACTTTT TTTTTTCCCCTTTTCACATTTTTTGCCATTTTTTTATATTTTTTTTTTTA TTTAAAAAAGTTTTTTTTTTTAAAGGGGGCCAATTTTTTAAAAGTCCGGT TTAAAATTTGTTTCCAAATCCTGCTTTTAGTTTTCGGTTTTTTGGCCCAG GGAGCCGGGGAATCAAACTGGCCCCCCCTGGCCCTGGAAGGGGAAGTTTT CGACCCCCAGACCCCCAGGGAAGTCCCTATTTGATATTTTAAATGCCACT TTTATAATTAAAAACAATGTGTAAAAAAAAAAAAAAGCTTCATAATTTTC AAACTTTTTGTGGTCCTAGAAAAAAATCTTCAAATGTTTTTCTATAAGGA GATTTTAATTTCAACTTCAAGGCAGTTTTGACAAACATGTGGCTGCCCAT CTGTTTAGGTGGTTAAATACATTCTTGCCTGGATACAGGGATAGACCTCA TAATCCTTCAAGGCCACTTCAATCTCTGGATTTCCTATAAAGTGTAGGTG ACCAATTAATCAAAGAAGCAGGACTTTTTCCCTAAATAACAGCAGGCGGA TGGTGTTGTTGGGTAAATTCCCCCAAATGAGGTAGCCAGCCCCTTAGAAA ATGGCTTCCCAGTATTCCTTGACTACTGTTTTCTTTCCTGAAAGACACAC ACACACTCTTTCTCACTCAGTCTGTGCAACCAACCTGAACCCTGGCAGTT CAGCTTCAGCCAAAGGGCCAGGGGAAGCCCCGAGGCAGCTAGGTTCTGCA CCACTGCCACTTACAGCCTGGGCGGCAGACTTGGGAGAACAAACCCTGAG AAGAAAAAGCTCTGTGTTATTAAATCATAGAGGCTGGGGCGGCCACGGGT GGGAGTCTGACACCAGCACCACCTGGTACGTGCAGGAACCCAGTTACGTA GTGACGTCCGCTATTCCTGTGAAGGGCAGGGTGGAGAACAGGGGTGTAGA CAGAGCCTCTGGCTGCCTGGTGGAGCTACTGGCAGTTGATTTTTCAGAGC TGGTAGGTTCTCCTTTGGAAAGTTACCCTTCCGTCTCCTATAGACCTCTT CCCAAAAGAAACAGCTGCATCTGCTCACCCTGACTTTTGTATTTAACTTG GTTCTGAAGCTAAAGCAGTGGAAAAATGACTGAGGAACTGGATACCCTCA CTGAAGCCCCAAACAAGCTGTCTGAGTGACTTCTATCCCATGAGGCCCAG AGAAAAACAGTAATGAAATGAAGTCGCTTCCTGCGGTGAAACAAACGTGG GAACATTTATGCAATTGTTTTTATTTATTCAACTCTAAAGATTGACTGCA GCAATTTTTGGATGGTTGACACCTTAGATTAACACTAATTATATTGCTAT AAATTTGGTTCAGGGTCAGAATGGGAATCAGGAAAGAGGAAGAACAATAG CAACAAAAATCTTCAAACACTGTAATGAAGAAATACTTTTTTCCCTTGAA TTAATGCTACTTTCCCATAGACTTCCCTAGACTGGTTTGCAGCCTAAGGT CATAGAAAACAAGGCTTGGGCATATGGAAGAAACCGCAGGTTAAGCCATG GTGCCAAGCGAGAGACTAAAACCGCGATCTGAGTGTCAGTCTCAGGCACA GCTTAGGAGCACAGGCAGATTCTCAAATGCGTCCCAGGGTTCTTCCATTT TCACCTATTCAATCCCCCCTTTTCTGGCCAATTCAGGGCTGTACACAACC CCCTCGCTGCCTCTCCTGCTCACACTGTTGTTTACAGGGAACCCAACAGG CACGTGCGGCTCCTGCTGTGACAGAAAGGTAGCAAGAGCAGCCGTGATCC ATCTTCTCCTGAACGCCTGGACAGTTGGGCTGGCTGAGGATGGCTTCTTC AGGCCTCCGGAAGGCCCGGAGCCCCGGGAAGAACACTGCTTACCCTTGGG AAACCTGGCAACAGTTGCCTGTGATTTCTGGTGGAAATGACCAATCAGAA TCAATCCATCTCACCGGGAAAGGTCAAGGGAAAGAAAAAAAAAAAAAACG CTTCCCTTCCAAAAAACGGTAAAGAGGAAACGAGGAGAGAAGAAACCAAA ATATTTAGAATGGCAAAATATTTAGAATGGCATAAAAAGTGATATGCGTA AACTTCTTTTTGTTATTAAATCTAACTGTAAGTTTCCTAAAGTCCAGTTA CCAAGTTGAATTGTGTGGGAAAGAAGAGAGAGACCGGCTGGAATCTTCCT CAGGAGTTCACAACGTCAGGCTGAGAGGTCCTAGGTTTGCGCTGGGGGAG CCCCTTCCTGAATGAGGGCTTGGGTGGGCCGGGCTCCATGCTGGCTCCAG TCCCATTGGTCCCTGCAGAGTGAGCCTGGCCCCGTTCACTAGTGTTTCCT GGTGCCTGGGGTGGAGCACTCTGGTACCTGGAACCAGATGAATACCACGA GCTATTTCTGTAACGACCCACGCTGTCATGTCGCCCTTGGTTCGTGGGGT CACTGGACTTTGGGCCTTGTGGCCTGTAGCCTTGTCCTCCTCGTCTGTTT CCCGGCAATGCCTAAGGATAAAAGAATACAATGTTCAGAGCACAGTGGTA TAAGGGCACCCCAGGTGTGCCAGTTCCGTGCACAGGAATATTCTGAAAGC CTAGCAGTGGTATCCCATGCCTGGGACTCGGTTCTCTCAATACTCACAGA ATTTGGTCAGCCGATCCAACCTAGACCTAATGAGAACTCATAAATCTTTC GCTATCTCCCCTCTGCCTTTCACCTCAGGGTCCTCGCCCCTGAAGAGCTT TTCTTTAGCTGGGCTGAGGAAGAAAGAGCATTCTCTGGGGCTATTATAAG CCCTCAACTGGGCAAGTGTCTTATCACATGTCGAATTTTGTAGATCATAA ACTATTTGTAAAGATAATGAACATTTGAATAATAATATACGCCTCACTAT GCTCTACTTTGCTATATATCATGAACCACAAATTAAATCACGCTGCTGTG ACATTTAACACATTCACAGTACAACCCGGAGAGCTCATGGCACAGGATTT TATTTTTGTCCTCCAATTCCAATGTAATACCACTCTGAAGAATTACTTAC TTCAGGCTAATTCACAGCACTGCCTTGGATGGCTCTTATGGTATCTCCTT CAAATCAAGGAAAGGCAACTATGGATTCTGCTTCAACTTTCTAGTGTCTG CTCCCTGCCCTACCTGGTTCATGCTCTCTCTCTCTCCTGGGTATGCTCTC CCTGTGCTTCCAGGGAGCTGCTGCTTCAGACGCATTCTGGCGAACCTGCC ACTGTGGTGCTTTCCACCTCCAGATGGGTGCACGACTCCCAGTGTGACCA ATTACCAGGCAAGACTACTGCCTACGACAGCGAGGATCACTGCCAACATC AGAAAGTCAGTAGTCCTGGCAACAGGAAATCTAAACTGGCTGGTGAACTG GAACATACACACCAAACCCTTTCTTTGGAACTAACTGAGGCTGGAGGGAT TCAAGATAGATGTGGAAGGGGCATAAAGAGAAGCGGGTCATGTACTGAGC TGTCAGCGTTTAAACTGTGACAACCTGGTTTAAAAGCTTTTCTGCCTAAC ACGCTCAGTGGAAGCTAGGTTACCTCTCGGTGAGGCTGGTAGGATCGGCC ACCGGAGTTTGCTGTGGTTGCAGGCGTCTCTCCCGGTGCCGAGTTCTTCT TTGTTAGCGCTTGTAAGGTTGGGAAACAAGTTTCCGGTGTAACTATTTCC ATCAAAGGAATCGCACGGGTTCCTAAAAACCCAAATTAAACCAAGTTATT CGAAACCGGTCCAAAAATTTGTTGCTCGAAGGGAAATTGCTATCAGCAAA AGAACAACAACGGCCCCCAGTGATAACAAAATTTTCCGTCAACTACTCCT CCGGGTGCTCTCTTCCCCATCGAAAAATTTTGCACTAAAAATCTGATGTA TATTTGTATAATTTAAGATTTATTTAAGGCTACTATATGAATTTATCTTC TTTGTGGTGTTTTTTTCCTTTTTTTTCTAATATTTTTTTACTTATTATAT TTTTTTCTTTTCCGCATTCCTCTCCTGCTTCTATAAATACCTATACTAAT TTATTTATAAATTCCATACCCATATTCCTGTATCCTCACCCGCCTCACTC ACCTCACCACACATT project fbnu AO 20040903 3985bp TGCCTGGAGAATTCCATGGACAGAACAGCCTGCGTTGGCTACAGTTCATG GGGTCGCAAAGAGTCAGACACAACTTAGTGACTAACACAACGACATGGTT GTCACTAATAGTACATTAATACACCGTTAGGGGTAGTGTAATTTGGTACA GACATTTTAGAAGGTATTTTGTAGGGTCTACTGGTTTCATATGTGCATGC CCTTTAACTTGGTCATCTCATATCTAGGAAGCTGTCTTACAGAATTGTTT ATGCATGTGCATGAAGGTGCATGGAAAAGATCCTCAGGACAGCATTGTTT ACAATAAACATCTGGGAGAAACCTGATTGTCCATTTCCTGTCCATATCTA TTCCTTTACCGTTCATCTGGTTACTTTGGGCAAATACAGGGAGTTATCCT TCATTTTTCCTTCTGCTTTCTCCATACCCACTCTATTACCCTGCCAGTTT CATCTCCGAAAATATGTCTCAGATCTACACATTCTATCTCTACTGCCTCA GTCCAAGCCAGTATCAACTCTGACTTGTATTACACCCAACAAATTGGCCT CCCGATTTCTTCCACTGTCCCTTTCTCCATCCTCACATCCATTTTCCACA AAGCAGCCAAATTTAAACTACAAGTCAAATAGCATCATTTCCTACCGAGA AATCTTTTTAATGGTTTCCTTCTTGAAGGAAAAAACAGCAAACTCCTGGC TTTGGCCCCTAAGAGTGCATTATTTTGGCTCCTGCTGACTTCTTTAACCT TACTCGCCCTCCTGATTGCTAGCCTCCACGTTAGCCTTCCTTGAGTTAGG ACAAGTTCCTTCCTTGTCTCAGGGCCTTTGCACAAGCTGTTTCCTCTCCA GGAATGTCTTGTCCTTGGATTTTCAAATGGTTCAATCTAGTTTATGCTTC AGGGCTCAGTTTTTATAATATCACCTCTCAGAGAGGCCTCTCTTCCTTAT TATTCTCTATCTTAGCATCCTATTAACTTCTTTTGTATCATTTTCTATTT TAAAATTCTTTGTTTAATTGTTTATTATCTGTCTCCCCACTGTTGATTCC ATGAGGGTAGAGACTTTCTGTATGCTTATCACTATCCACCCCAATACCTG GCACTGGGTAGGCCCTCAATAAATGGTTGTGGCTGATGGGAATCTCCAAG ATATGTGTGTGTGTGTAAATATAATAGTCTAAAAGGGGAATTAAAAGAAA ACTACATATAATGCTTTATAAAGCAACATGTTTGTATGTAAATGTATAGA AAAAAAGGCCTGGAACAATCAATACCAAGTTGTGGGTTCCTGTGGTTACC TGTGGAGGGGGATGGATAGAGTTGGGGACCAAACAGTGATTCCTTTTTAT TCTATAAGCTTTTGAGTTGATTAATTTTTTAAGCTACACATATCCACATA TTTGTTCCTCTTTTAAGGGAAAAGGAGGAATAAAAATAGGGGAGGAAGAT TCAACTTTTGCTGCAAAAAAGAAAGCTCCTGTCTCTCTGCACTGATCCAA AAGAAGAGAGCAGGAGGAAGAAAGGACACCACTGGGGTCATTCCCTGCTC TGTACTGAGGTTGGCACTAGTTTTCATAGTAGGAAGAATCCTAAGAGATG CCCTTATTCCCTGAGGCTGTATTTTAAATTCATAAATGTAGGCACAATCT CGGTCCCCTAGACACAGGCAGGTTGTGTATTTTTAGCCTCTTTCATTTCT AGGCTATTGAAAGCTGCACCTCCAGCCTCAGCAGAGCTTTAGCAGATGAA GTTAGCAAAGAGAATAAACATGAGCTCTGGGCTTCACTGCAGCTAAGCTT CTCAAAGTTAAGTCAGTTCAGCAGCTGCGAACTGACTTAGGAAACTGTGT TCTCTAGATTCTAGTCTCCCAGAAACACGAATAGCTCATCATTTTCACAG CTAATGTTTGTTGTGTGCTAATGGTAGGCTGGTCACCTGGCAGACTCTTT ATACACGTTATCTCATTTAATCTCCACAACTTTATGAAGTAGTTATTATT ATCTCCATTTTATAGATGAGGAAATGGACGTCCAAGAAGGCTAAATAGCT CACCTAGGATCACACAGCTGGTAGGTGGTGAAGTCAGAATTTGAATCTAA GCAGTTTGACTCCAAAACCCACATCCTTAACCACAATCTCCTTCTCTTTC TGGGGTCAGCACCTCCCTCGCCTTCAGTATTGTTTTGGTGGGGATTGTGT ACATTACAACAGAAATCAGGGGAAGTAGGACAAGTCATCTTTTGCTGAGA GGTGTGGTGGGAAGGTCTGGGCTTCAGAATCCCAGCCAGGTTTGGGTTTG AATCCCAGCTATCCTGTAGGACATTCACTGTCCAACAAATGTTTCCTTCT TCATTTACTCTGTGCCAGTGATACCACTGGGTATACAGTGGTGAAAAACA TATATCACCTCTGCCTTCATGGAGTTTATGGGAATGCAGATATTAAATGA ATAAGTACTTAATTACAAATCGTATGTCCTTGGAAGGCAAAGAACAGGTT GTTAGGAGAGAATGTAACCAACACTCCCCTTTAAATGAAGGCCAGAGGCA GCCTTGGGATCTATGAGAGACTCTACGTTCATCTAATTTTCCTTCCTATC TTGCTTTACTAAGAAAATAGGTCTTAAGTGCCCGCTGTATATACAACACT TTCCTTGAGTGCTTTGGAGAATACCAAAAAAGAGAACAAAAAAGGAAAGA GAAAAGAGGCAGAAAGAGCGGGACGGAGAAAGACGAGAGAAATAAAACAA GGACATGTCCTCGGCGGAGCGGAGAGGAACGCAGCGGGCCACAGCAAGAA AAGCCAGAACGCGGGGGGACGGGGGGNCGAGCCCAGACACAAGGGAAGCG AGAAGACCAAACGAGAACACGAGGCGANGAGGGGCCGCANAGCACCAAGC ACAGAATTACTAGAGGGATAGGGAAGGATTAGCATGGCCTAGGATTGCTA ATCAGGCAGTGCTCTCAGAAGGAAGTGGACTTGAAGTCAGGCCTTAAAGG GGACAGGTGTGGATTAGGGGAGAGGAAGCGGAAGGCTAGAGCAGAATGGG AGGGGAGTAAAGAGGAGGAATGAGCCAGATCTATGAAGGGCAGCCAGGAG ACCCACCTGTCAGGGTAGAAGATCCTAGCTCTAGACACAGACGTGAGCTT GGATCAGAACAGTTGGCCAGTTCATAGAGAGTTTGGTCTGAAGAGCCCCT GATTGGTAGAAAAGGCTCTGGAGGCCTTCCTGCCCAGAGTTTCATACGGG AATAGAGATTCGTTCGATTAATTGGTTCCTGGTCTTTCATGGGTCTTGGT TGTAACAATGAGGGAATGGAATTATTCATAATACTTAACAAATCCTTCCT TACTTTAATTATCTGAAACCTGTACTACTTTCGCCTCTATCCATAAGTGG TATGTAAGAAAATTACCGTTTCTTTTTTGTTTGCAATTGTACCAGCGTAA ACGCGTCACCTTGATGTAGGTTGAACTCTTGTAAATTTTGGCATTATACT GCTTGCTTAACCTAGCGTTACGCCATACTAATGTTTGAGATTTTGATTTG TGTAGGTTCGTGGTTCTTTTCTTTCCTTTTGTTATTTTTGTTATCTTATT TGGTTGCCATTGTTGTCGTTTCCTCTCGCCTTCTGTTGTGCAGACATGTG TTCTGGCGGATTTTCTTATTATGCTCTTTGCCATTTCCACCCTGTTTACA AAAGTTCAATCTGCTTANTTTTGTCGCTTTGTGAAAGAGCTATGCGCTTG TCAGGGTACTTCTCCTTCTGATTTTGTCTCGACACTNAGATTCTATTAAT ACATATGATTCGCCTAGATACTTTCTGACACCATACTTGAAGTATTATGT GTATTTAAGGATCACCCAGACTGCTTTTTATGTTTTTCATTTAGTGTGGG TATTTTTTTTCCCTTCATAATGTGTAACACCCACATACATACCTATATGA ATATTTTCCCATGGACTAGTCACAGTACTGTGAAT project fbnu AP 20040903 3808bp AGGGCCATACGTATGGCTAACAGTAGTTCATCACAAAATACTGTGTCGTT CATTCATCCCATCACTGAATTCTTGTAGGCGTATAGAGATTGTGATTCAC ATTTTATAGATGAGGAAACTGAATTTCAGAGAAGTCTAGTAACATTCCCA CTGTCTCATGAAAAGTACCAGGACTCAAATCTAGGTTCTCCCTGTTGCAA AGCCCATGCCGTTATTTATAGATGGCTCTGAATGTTTAAAATGCCATTCA GATATGAAGGAATTGTCACTGGTAGTATCCAAGAGGGAGTTCCCTTGGCT TTCTGCTCTGCATGGTGTCCCTCTTCCTGTGAGACAGAAGCCTTGAACTT CAGGTGTCGGGCACACATACCTCGTTCAGCTAGTTTCACCCAGTCTTGCT GGACAGGGAAGCACTGTTTAATGATCAACCAAAGTCAGTCAGACAAATCC AGGTGGGCCTTTCCAAGTTAGAAATGGAGATTTGATTTCTTTGAAAGGAG ATGGCAAGATATGGCAGAAAAAGGCATGTCCTGTCAAAAGTTCTGTGGGA GGCCACATATCTGGGTTTGAATCTTGGTTGTGCCTCATTCGGTGTGACTT CAAGCCTGTTGGTCTCAGATTCTTAATTCTTTCACCAGTTAAACAGGCAT AACACCACTTAACCTCCACGGGTTACTGAGAGTAGTGATAAAAGTGCCTG GCATGTAACAGACGCTCAGTAATGTTTTCCTCCCCATCTGTGGCCCTGAG TGGTTATGACACCCAGAATGCCAGACACTGAGAGAAGCAGACAAGATTCA GAGTCTCTCTGGGTCAAGGGGTGGGAACTCTTATGAGGCTGCCTCTAAAC AGATGTTTTTTGTTTTTTGTTTCTGGCTGGACGATCAAATGAGATACAAA AAGGCTGGGACACTCAAAGATGGGGTTGGGGGTGTGGGCAGTCATGACCC CTGTGTCAAGCTCTGGCCTTAACAAGTATGAGGGAGGGACAATGTTGGGA AGGCGGGTTGTGGATCAAGAGCAGACTGGGGTCTTTCTGTTTCCTCCCCA AAGAGGCGAGGTGCTCCGAGGCACTGAGATGGACCCCCGTTTGAGAGCAA TTGGAAAAGCCAGGGGAGATAAGACTTGTAGTGCCTCTCCCCAGCTGATA TGACTGGTGCTGGGCCTCAGTTTGTCCTTCCATAAAGCAGGAGTCATGCC TCTCCCACGTGTAGTCTGGACGTAGGAAGGGATTCATTAGGTTTTATGAC TTCGTGATAAGCTCCTGGGTTTATAACGAGACTCCTGGAAATCCAGACCC AGTGGTACTGGGTGGGGTGGAGTGCTGTCCCCAGCCGGCCACACGGGCAA CTCACAACACCTATTAGGCTTCTTTATGTCAGATTGTCTAGGAACATGTG AGATCAAGGAAAAGTCCATGCCCTCAGGAAGCTTACAGTCTAGTTCAAGA AATAATACAGAATGTGAAAAATGAGTAGCAATATGGGAGTGAAATCATTT TGTTTTTTCATGAAATCTTAACAATTAAAAGATCTAGCATAGTGTTCAGA CCAAAGTAGATATTTATAAGCCATAATTTTTCCTTTTTTGGGTAAACATA TAAAAGTTATTGCCAGACAAAACAAGACTTCCGGTTGGCACAGTGTATGG TGCCCCGAAGATGCTAAAGGAATGGTGACATGTAATCGTGGATGGGAAGC GAGGGCAGTAGCCCTGCAGAGGTTCAAGGGACGGAGTGTGCAGAGGTCTG GGTTGTTTGAAGGGGGCTTCATGAGGCACCTTGATCATATTAACCCTGAA GGATGCATACAATCCGAAAAGGTTCAGAGAAAGGCTAAAACAATTGGTTG TCTCAGAGGAGGCATTGTGTGAGAATACAAAGTCAGGATCAGACCTGGGT TCAAACCTCAACTCCATCACGCACTAGCTGTGTGACCTTGGGCAAGTTCC TTGGCCTGCCTTTCCGAGCCTTTGTTTCCTCACTTGTTAAATAGGAATGA TTTTGGTCCTAACTCCATAGGCTAGTTGTAAGAATTAATGAGATAATTTA TATAGAGTTCTCATCTCAGTTTTGTCAATAAATGTCATCAGCTTTTGTCA TTATTCCATTTTTCATTTTAATGGTAGTGTCATTAGTATCCTACTCATGC CCACAGATTTACCCTTAGTTCCTAGGACCTTGTGTCATCTGGCCATTCCC TGCCTGCTGTAATTTCCTCGAATATGCTTTTGTTCTGTTATTGCAGATCA CTTGGAGACTCCTGGGCTTTTTATGGTGTTTTGTACTTCTGTGTACTTGC AAATGCCATGTCCTTGCCCAGAATTTCACCATCTTCCCCTGCTTCATTGC TTTTGCCTAACTTCCTCCTGCTTGATGTTTTAAGAGTAAATCCTATAGCA TTTCTTCCAGGAAGCCTTACTTGACTCCTCTGTTCCGTTTCCTCCCTGGG ACCCCACAGTGCCATATGCTGCTGTTTGACAGCAGTACTGTGTGCACTCA TCCCTGGCTTGCTGATCTACCTTGGATATAAACTTTCTGAATGTAGGGAT CCTACATTATTTATTTTTATATCTCTAGCTCCTAGCTTAGTGACGGGCAT ATAGTTATTTTCTGCTAATTGTTGAATAAGAAATCCCAACCAAAAACAAA CAAAAAACCAAGAAGAACACAGCTAGCTTTATGTGTAACATTTATTACCT AGTTAGTTCTGATTTAAATGCTTTGTGTATACTAACTTATTTAATTGTCA TAGCAACCTTAAGAAGTAGGTACTGTTTGTACCTCCATTTTACAGATGAG GAAACTGAGGCTCATAGAAATTAAATAACTCTCCCAAGGCCACACTAGTA AGTGGTGGAACCAAGATTCGTACTAGGGCAGTGTAGCTCCTCATTCTGTG GTTTAGCCACTCTTTGAGATTTGTGATGTTTATTGAACGCCCAAGAAAAA GTGAAGAGACATTAGCTGTACATCACAACTCCATGAACACATGCTAAAAG CATTAGGGAACGTGTAGAGACACTTTTAGGGGAGAGTGTAAACCTTCCCA GTCTTACTTATGACAGATTTGCTAGAGAAGGTGGGATTTCTCCCCTTGTG AATTGGATGAGGGGCATGGCTGGCGGCTGGGAAGGAGATGATCTCTGAGG ACGATGGAGGAGAAATCTTAGGGAGTGGATGAAGAATATATGTCTGGGGA AATTCAGTTTGCTGAGTCTTTATTGAGCACCTACCGCAGTGATCAACAAG CTGGTGATGATGATGCCTGTGCTCAGGAGCTTGTGGTCTAGCGGACTTTA AGTGCATCTGGTTAGACAATAAGTCAAGGGAGTGTCTTAGACTTATAACA TGAACCGAAAGACAGAGTTGAAACCCAATGAGAAGTGGGAATTTGGTGCA GGAGAAGCAACATATAAGGAAAGTGATTTGGGCTGTAGCACATAAGGCAG ATTATAAGACCAGAAATAGCAAGGACAATTGTGAGAAGTTGGATAATCCC CTCCAAAAATAACCAGGGACTGAACAAAGGACTTGGTGGTGGATGAGGTA GTAGCAGGATCAATCAGTTATTTATTAAGCACCTGCACATGATTCAGAGG AGGATAAGGCATGACTCCTCCCCTCCAGCAGTTGTATTCTAATTGAAATA AAGGAAGCACACGCATGAAAATGCACTCTATGACCTCATTCAAAGGGTGT TGAGATCCACAGTCTCAGTGACCAGGTACTTTCTATGTCTTTGCTTCACT CATCTGGATTTCATTTCTAAGGTCACCTCATTTTGAGAACTACTGCATAA TTTCCCCC project fbnu AQ 20040903 3555bp TTCCCAGATTCCAACAAATCGGTTTCCATTCAAGAGGAACATTCTGCGCC CTCCTCAGAGAAAGGTGGTGTTAATGGTTATCATGTCACGGGTGCCATCA ATGATACTGAGTCTGTGGACTCACTCAGTGAAGGTATGGAGACACTTTCA ATAGAAGCCAGAGAACTGGAGGATCCTGAGTCTGCCCCATCAGAAATGCT GGATAGAACAGGTGAGTATTAACAGGTCCTTGGAAAGTTCCATTCTACTG AAAAATACAGGGGCTCCTTGGCTGAGAAAGCAATCAATAAATTAAATCTA GTTAGTTTTTTAACTTTGTTACTTCTTATGTGAAAGAGTCAATTTGGTAA TTATCAAGGGCCTAGAAAAATATAATTCATATTCCTTTGTTTCATATTTT AATTTTAGTCTAAATCAGCCTTGTGGAAATCTTCTAATTTAATAGTTCTG TAATACTTAGAGAGTACAGAAGGTGACCTTAGATGTTTTTTAACTGCACA TTTATTAAAGGAAATGATGATCATGAGTTGATATTGATGTTATTATTCCA AGACTCAACACAATAAGGAATATATAGGCATAACTGTAATCCCATGGCTT TCATTAGAAGTAGACTGTTGGTTTTTATAGTCTCACATTTGATTTTTAAT AAAGAATTAAGATTAGTATTAGTTGTAAATTCAGATAGCTCATACATTTT TCATTAACCGTTTTGATGAGTACTGGAAAGATATTGGGAATATATTTTTA AAAATAGGCTTTTTAATTGTTTGTTAAACCAGTTCCCCTTGCTCTATTGC TGCTGGCTTTATACATGCAATGCCATTTTTAAAATTACGCCGTGTATTTC AGATGTTTTTATTTATTGATTAGTTTGAGCACACACACACACACATAAAG ACTTAGAAAAAAACATAGCACCTCAAACAAACCAAAGATAGTTGGTGGCT TCTATTTTTTTTCTGAACTAGCTTTCCTTTATTTCCTAACTCTTTGCTGT TTCCATTTCCTAAAGCTTTTGAAACTCTACTCTCTTTCTCTGAGACAGTG TAGAAATCTTTTTCTCAGCATAACTTAAGAGAAGCTTGTCAGAAGGTAGT GATATTGACTCTTCACTTCCTTGTGCCCAGAACTGCAAGGAAGTTAACAA GATACAGGGAATAAGCTAGCCTGTCTGGAGATGGGTTAACAAAGAATCCT TCTCTTCAGTTGGTGTGCCTCCTTGGGCTAAGCCAAGTGATACAGCCTCA CTGACTCTGCTCTTTGTCCTGTTTTGTCAGCTGATTCTATTCACAACCTT TTAAGAGGCAATTTTTTGCTGCACTTTTGCCTTTTTACTTCGTGTGTACT TAAAGACTCCTTGATTTACCCCTGAACTCTACTCTAAAATACTGGCCTCT TTATTTGACAGGATCCATGCTGGAGAATGGTGTCTCTGATTTCGAGTCCA GATCTTTGACTATGCACTCTACTCAGAATTCTCAACAAAATAAGAATGCT GCCAAGTCTCTCTCAAGAACTACTGTAGGACCTCAGCTTTCAAGTCTAGG CATGGAAGATGTTCCCCTCTCTTCCACCAACAAAAAGCTGGGTAAATCAA AGATCTTCCTTTGAGAGAAAGCAAAAAGAATCTGTGTTTTTAGCTAAAGA GGGCAAATCATCTCTTTGTTCTCATAGATAAGGTTTCAGAAGGGGCAGCA GGTAATACATTTCCAGTCAGTGACTATCCATGACGATCCAGCCTTTCCCC AGTTTTGTGTACACAGTTGGAGCCTGATAGTAGTATAATGCTGTACAGTC TTGAGACAACAATAGTGATCCTTTTTTTGTGAATGAGGGTCAAACTCTGT GGCTAGCATGGTGTCTTTGATAACATTAACCTTTGTTTTATTTGTTTTAC TGCAACATGTCTGTGCTGTTTCCTTCATTTTTAACTCCTGGTTGATTCAA CAGTAAAAAGCTTTGCCATCTCTGAAATGATATTTTGAAGAAATATTTTA ATTTCTCTTCTCAACTTCATGCTTTTACTAATATCTATCAGACTGTAGCT TTAAACAAGATCATTTTCTCTTAAGTAAATACTTAGCATTGATTGATGGT AGTGATTTGTTGGGTTTTTTTTTTAACTTATAATACTTATTTAAATAATC AGCCAATAATTAGATAGAGATAATAGCCCTTCTATCGTCCATTTAAGGAT GGCAGTCCACTTACCTGAACAAATGAAACAGAGAAATGTAAAATACACTT GTAACCTGTAGCTCTGTATTGAATTATGTATACCGCATGAGCCAAATTTA ATTATTGAGGCTCTCCTTTTTCATCTTTCTAACAGAGCCCTCAACTTGTC CAGAAAGGCAAGTCTGAAAATATTTATTCAAGCAAAAATAAAGAAACAGT GCTTGAAAGCTTTTAGGTAGATTTTAAAAGAAATAAGGTTGAGATGAGGA AAGATTTAAAGATTGAAAATCTGTGTCATGGCACTTTATAAATTTGTTAG ATCAGTTATTCTAACTATAAGTTATAATAACTGACACTGGTGAATATAGA AAGGTTATAATAGAATTCTCAGAAACTGGTTAAAATATGTTAGGTAGGTA AATATGCTTCATCTTTATCTACAGTGTTGACTTACCCACTTACAATGATT CAAAGTGTACTATCAAGAGAGAACTTTATCAGTTTTGTTATATCTACGTG GTGAATTGTGTTCTACTAAATCCTGTTATGTAGGGAGTTTTGAAAATTTG GTACCTACTCAAATAGTTTTTCATTTTGGATTCTTTTTTTTAGTCTTTTT CTCTCTGTGTTTAATTTCATTATGGATAGTTTCTAAAATTGCTGTCTACA AATTTATTAATCTTTTTTCTCTAAGTTTTTAATCTGCTGTTAATCCAATT CAGTGTATTTTTCATCTCTGATTTTTTTTTTCATCTCCAGAGGTTCTGTT GGAATCTTTTTAAATATCTTCCATGTCTGTCCTTAATAGATTATACTATT CCTCCACCTTCTTGAACATGTGATATTTGATTATATTAGCTGTTTTGATG TTCTTACCAACTTTATTCTACATCTTTGTCATTTCTGCACTTGTTTCTGT TAATTGATTTTTCCTTTCATTATAGATCAGTCATATTTTTCTGCCTCTAG TAGTTTTTTAATTGGATGCCAGACATTGTGAATTTTGCTTTGTTGATTGC TAGATATTTTTGTATTTCTTTAAATATTCTTGTGATTTGTTTTGGAACTG TTATTTGGAAACAGTCTGCTTGCTTACTTAAGTTTTGTTAGTAGAAATAG AGCAGCCTTTAGTCTCAGGCTAATTACTGAGGCAGTGCCCTCTAAGTACT CTGCCTGGCGCCCCACTATGCTGGTGTGAGCATAGACTATTCCTGGCCTG GGTGAGCTCTCAGGATTATCCCACCTGCTCCTTACCAGTGGTTCCTTCCC CGTTTGGGGCGGTTCTACATTCGAATACACTCAGAATCCTCTGTGGGTCT TTGTACGGTTTCTTCATTGCTGTTGATGAACTACNNGTACCCATCGATTG CCCCC project fbnu AR 20040903 3501bp GGGGTGATTCGACTGGCAGTAGTTCATCACATGAGTTGCAAGGAGCCCAG CTTCTCAGCCACCCTGCCCAGTTCTGGTCATTGGCCTAGATGAGGGTGTG TGTATGTGTGTGGTGCGTTGGCTTCAAGGGCCAGCCTGACCAAGTATGTT TCAAACTATGCAACTGAGAGACTCCTGGGACTCACAGCTGAGAACTCACA ACCATTTCTACCCCGAGCATTGGTCCGTCCATAAAAATAAACTTGAGCCT TCCCACCCCGTGACCGCTGGGCTCAAAGAGAGACATTGTGAGCCACACCT CAACCATCCTAGTGTGGCCGGCTCAGGGCTTCAGCCCCGGGGCATGTCTC GGAGGAACAGGGGCTATCTCGGCAGCCTTTTCCAGTAGTTCCTCAACCAG AGGAGACTCCAGCAGGTGAGACTGAGAGTTGGGAAGGGAAGAGATGTGAC ACGAAGGATGGTGACAACTATCTGAAGGGGAAGAAAACCCTGGAGAGCTT GTTGCTCCCCATTCTCTCCCTTTCTGCAAGTCTAACTTCGTCTCTTTTTG TACTTTCCGCCTTCACACCCCAGCCAGCAGGGGAACCAGATGGAGGCCAT GTGGAAAATTGATGTGGCTGCCTCCAGTTACCCCATAGAAAAGAAGACCC CCACCAGCCTGTCCTGGGACCAGCTAGGAGGTTTCCCAGACATTCCCCGC CTGTTGGCACTGGATGTGCAGTCCTCCTTCCACAAAAGCTTGATGTCCCT CAAGGCCCGGTAAGGTTCAAGGCCAGATGGTCAATCTGGATTCAGGGACA CCTGCCCATTAAGGGCAGGGGCCAGAGTAAACACTCCCTGTGTCCAACCG CCCAACAGATATCTTTCCAAACATTAATGATGACTCACTGTAACACACTG AATCTGCCCACAATGCAGGAGACCCAGGTTCGATCCCTGGTTTGGGAAGA TTCCCTTGGAAAAGAGGAATTCTCCAGTATTCTTGCCTGGAGAATTCCAT GGACAGAGGAGCCTGGTGGACTACAGTCCATAGAGCTGCAAAGAGTCGGA CATGACTGAATGACTAACACTTTCACTTACTGTACCACATCAGACAGACA GATGCTTACCTGCCTCATCAGGCATGAGCTTGGGTCCCCACACCAACACC ATTCTAGTTCTCTCAAAGACTCCACATGGCATCTCAGAAGACCAGGATGG AAGTCTTTTCTTTCCACTTATTTCCTGGGACTTGCATTTAAATTACTCAA GAGTGTGTCTTGCCCTAGGCCTGGGGGTTGTTCTCAAGGTGAGCCAGGTG CAGGTATGGAGAGATGAGAGAGACCAAAAATCTCAGGATAAACCTGGGCC CATCTTTGGCACTGTTATTTCCTTACCGCCTTCAAGAACTGGCCCCGGGA AGAGCAGCTGAGGGGAGGGAAGTGGGACTCAGTGGGGCCAACAAAAGACT TTTCTGGTTAGGAAGGTTCAACTCTGCCTCTCTTGGCTTGAAGACTCAAG GTTCTTCAGGGAACCCTTCTACATTACTAATGCCAGCTGTCTCTTGTGGC CCTGGCCATGCGCCATCTAAAGATCTCTGACCGGATAGGAATTCCCTGGT AGTCCAATGGTTAGGACTTGGCACTTCCTTTGCCGGGGACCCAGTTTAAT CCCTGGTCAGGGAACTAAGGGGCTTCCCACGTGGCCCTAGTGGTAAAAAA CTTGCCTGCCAATGCTGGAGATACAGGAGACCCAGGTTCGATCCCTGGAT CAGGAAGATCCCCTGGAGGCAGGCATGGCAACCCACTCCAGTATTCTTGC CTGAAGAATCCCATGGACAGAGGAGCCTGGCGGGCTGTAGTCCATGGGGT TGCAAAGAGTCAGATGTGACTGAAGCAGCTTAGCACACACACACAGGGAA CTAAGATCCTGCAACAAAAGAATGAATGAATGAATGAGTTAGACAGGGAG CGGGCACTGATGCCTGCCAGTCTAGACCTAACTGGAACCAAGCCTGCAAG ATGCTGGTGCTGCCATTGTTCTCTCGACAGGGACTGAGGGAAGACAGGGT GGCCCAGCAGCATCAAAGAAGGCTGGTGCTCGGCTGTGATCCTACTCTGA AGTGGTCCTGAGAGTCCCAGCTGGACATCAGCATAGCCCACCTAGTACAT ACATACCTGGCTTCGGTTCCTAAAGCGATTCCAAGTGTGTGGGTGCGTTG CTGTTATTGTTAGTTGATTTGGATACAACAGAATTGAGCAAACAGAATTG AGAATAACCGAAACAAGTGTGGCAGAATTCAGTAACCCAGAAATCGACTG GGGCTGCACCCTGCTGAGACTGGGCTAAACTTGCCCTCAACTCCTGCACC CCCATAGTGGTGTCTCTCCTCTCTGAGCTCCTTCTCTGCATCTGTTTCAA CCTGAGGCACGAACCCCTTTGTTCTTCAGACACACATAAAGGCATGCACG TAAATATCAAGTAAACACATGCCACTTGGCCGCACGCGCTTCATGATGTT AGTAACTTTCTGAAAATTTAGGAAGGGGACAAAGACAGGGATTCACAGGG AACAGCACCACAGAGCAGCCTCCTTTCTTCCTCTCTTTCTGTATATAACA TGCAGAATGCAAAAACTCCTTCTTTGTCTCACGCAGAGCTCTTCCACCCA CACCCAGCCCTTCACTGGGATCTCAGCTTCAGATTTAAGCACTTATCAAA ATATTGCTCCCACCAAAGACTTTCTCTTTTCCAGGGGAATTTAGGTGAAT ACAATTTTCTTCTCCCTTTTCTAACTCCACATGCGTGTATTCAGTTTATC ACAGTACCAGGTGTAGAAGTCAAGCCCTGCTGCTTCTGTCTTCTTTACCC ACATGCCAGGTGGGCACCACCTACCTGGATGTCAAGCCGATCCCCGACAT TTCAGGGCAGTGCTGCCTGCCTTGTCCTGGGATCTCAGTTCTATGGCCTG AGAATCTCCTGCTCCTGAATGCAAGTTCTCTGCCGCTTTCCAGGCTCCTG CTGCCCCTGGGCTGGTGGTTGTGCTGCTGTCTTTGTGAATTCTCTGTGTG TATGCACCTCTGGAGACATGCTGCTTCCACTCCCAAAAGTGCATCCTGTC TTTGGCTGCCTGCCCCAGGCCTACCTCAAATCTGCATGTCCACCTGTTGC GTGGGTCCAGGCCACTCACCCCTTTGTGACCCTGCCCACCTCATCAGCTC CCCTGGCTGTGCTCTCCAGTTCACAGTAGTGGCTAGTCTCCTAACTGGAA CCCATCTCGGGCCAACTGTGCCGTTCTCCCTGTTTGCTTGGCTCTGGCAA CCTGCCTCATCAAAGGCTAACTGGGATGTCTTCTCAGCTTGTGGGGAAGG GCTCTTCATCTTTCCCCTGGGCTTTGGGACTGAGTCTATGAAAGGCCAGC AGACCCCCTCCTCCAGAAGGTTTCTCTACTGTGTTTTACACATGTCTCCC CTGGGCGCTCTGTCTGACAGGTAAGATGAGAACTACGTACCATCATGGCC C project fbnu AS 20040903 2868bp CGGGTGATGATGCAGTAGTTCTCACTTAGTTATTTTCTCAGATGGTTAAA GAGTTAGAATTCTTTTAATCCTTTATAATTTGATTGGAGGATAATTGCTT TACAATGTTGCTTTAGTTTCCACTGTACAACAGTGTGAATCAGCTGTATG TACACATGTATCTCCTCCTTCTTGAGCCTCCCTCCCCGCCACCCCCATTC CACCCCTGCAGGTCATCACAGAGCACTGAGCTGAGCTCCCTCTGCTATAC AGCAGCCTCCCACTGATGATCTAGTTTACACATGACAGAGTATACATGTC AATACTACTCTCTCAATTCATCCCACCCTCTCCTTCCCCTGCTGTCCACA GTCCGTACTGTACATCTGCGTTTCTATTCCTGCCCTGCAAATAGGTTCAT CAGTACCATTTCTCTAGATTCCATATGTATGTTAATATATGACATTTTTC TCTTCCTTACTTTACCCTGTATAACAGGCTCTAGGTTCATCCACTTCACT ACAATGGACTCAAACTCATTAGAATTTTAAGTCAAAGACTATCAAGAACC ATGGAGGCCAAATACTAGTAGAAATAAGATGCTAATGTACACGCAAAAAC TTAAGAATAATTTAAAACTAAAGAGTGCTAGGTACCTTTCTGATAACACA TTATAACAGTAGCCTATTCCTTTATTTCTATGGTTTTTAGACATTTTTGA AAGTGCTTTTGTTCATAAAATGATTTTCTGAATTTTCAGCATCTCTATAG ATGAACTTTAAATTTAAGGATCTAAAAGCATTTGTTAAGACTAGTGATAG TTTAAGAAGAAAAGAGAAGCTCAAACAAAAGGAAGTAACTTTTCTAAGGT GAATGAAGAATCAGCCAGGAAAGATTTCAGTCTTAAGCACAGGCTTATAT TGACTTCATGTGTTTCAGAATCTCAAATTTCTTACCACTTTTCTCCTTTT AATAAGTACCTTTTGACTTTCAATAAAACAGAACCTTTATTTTAAAGGCA GGCTGAGTGTGTATCCTTTGCCCTGACACATACTATGACAACTGTTCAAA ATAGTTTACACACTCTAGCTTCATGTTCCACTTCGTATCCTGTTCCCTAA CAGACTTAAACTTTAAGTCAACTAGGAGCTCCAACAATGTGTCAGACAGA TTTTATTAATTAAAGAGAAAAGTAAACCTGGGTCTAGTGATGATTATTAC TGGATCACCAATAAGGACAGACGTGACGTTTTACATCCTGGAAAGCCGCT GCTTTTACCTCCCCACAGGTAAATGTCAGCTTTCATCTGGCCCCAGTGTG AAAGCACTTATCCGTATAATTCCCCTAGTGCCCAGTCAGGTGTAATGTAA TCTTACTGTTGCAAATTTGTTAGAATTTCTTTTCTTTTCTTCTATACTAT AACCAACACAAAAATGGCTTCCTAAGTGACATTAACTCCAAGCTCTGGTT CAGTGCCAAAGGGAGTTAGATCACCTGCCAATTATATCTTGAAGTAGCAA CTACAAGGGGCATGGAAATAAGCCAGTTTAAAAACCCAGTCAGCCAGAGA GAAGGCTTTACACCAGCAGGAAAGTGCAGGTAATCTCTTTCCTCAAGTTA AATTGACCTGGTTGCTACACCTGCTAATCAATCCTAAATACACAGTTTCT AGGCAGGAAACCGCTTCATTTGTCATTTATTAAAGGAGGCTCCCCCTGGC TAGGTTCCAAGTCAACAAGGACTCATAAGTCTCTCTCCCGGAACTGTATT TCCTGGTTCAGGCTGGTTCTGAATGGAATCAGATCCTGTGGCTAAAGTAA TCAGTAAACTAAACAATCATGGAGACCGGAGGCTTGTCAAGGCAAAGTTG TGATGTTCTACTTAGTTCTTTATTCTTAAGCCAATAATATCTGATGTGAT AATAATCCAGGGTAAAGGGCATGGGGCTTTCTCCCAGAGGGTCAGAAAGA GGAGAAATCAGTTACCTAGAAAAACTTCCAGGGGAAGTCAGAGTTTACTT AACGTGAATTTGGGAGAACTGGTTGGATTTAGATAACTACAAAAATACAA GAGAGCATTACTAGGTTGGAAAAGTAGCATCAAGGAGTGTATGAAAGAGG AAATGTGTATGTTAAATTCTGAGACAAGTAATCTGGCTGGAGTAAAAATG TATATAAGAAAACAGAAGATTTGACATTAAATTTCTAGCTATAAAACCTG AAAGGAGAAACTTGGGATTCATGACAGCATGGGTAGATGAGCAGATGAAT GATCTATTCTAAAGTACTTTTTGTTTCATGGATCATTCTACACTTTGGTA AAAGCAGAGGTCAGCAACTTTCTGGAGGCTTTATTCTACCTCTCTGTTAA TTCACTCCCTTCTTCAATTCCACACAACAGGAGGACTGAGGCTACCCACT CTCCCTCTGTCTTTTGTTCACTGTGGCATGAAGTACCAGACTAAGTTTGT GAAGAGAGACACGGCTGAATATGACCTCAGGGAACAGCTCCTAGACAAGC AAGAAAACGGATGGATGGTTGGGAGGAAGAGTGGTGTAGGTTCTCTATAT TTATGAAAATTTCCTCTCATCTTTCAGGTTCTTGAAAGTCTTACAAATAG GCAGTATGGACAGTCTCATATCCCTAAATACCAACCTAGCTGCTTGTCTT CCTGTCATTTTACTTAATTTGGTCTTTTTTTTTAAAGTCCATTATTAAAT GAAAATACCTCCCCAAAGGAGTTATGGTTTAAAAGTTAGTTACCATAAAG GTAGTTAAAACAGCTTCGATGTTCTAGAAGAAAATTAAAAGAATTTTCTC CCAAAGATTCTATAATCAAANTATATNTGAGAAACCCATGATGAACTACT CTGCATTCGATTACGCCC project fbnu AT 20040903 2422bp TTGCTGTTTGATTGACTGACTCTTTGTGGTGAGGTCTTGTCATGTAAAGG GTTATATAGCACAAGGCATATAGTGAGCTCATTAGCAATCCAGAGTAAAG ACGGAGTATTGCAGACAACAACACATGATGTGATAAGGTATATATAAGAG AAGGTGGGTTGCCTATGTGAGTAAATAATTATTAACACGTGAAGTGGATG AATATGGGGATGGGGAAAGGATAAGAGGGTGAGAGAAAGGATGGTACAAG GGAGCAGAATAACGGACGTGGGAGGGTGAGGGGGAGAGGGGAGTGGGAGG AGAAGGAAGTGGAGGGGAAGAGCGGAAGCATATAGTAGGGAGAGATGCGA GAGTAAGTGTGTAGAAGAAGGTGGAAAGAACATTGGAAATAATCGAAGAG TAAGAGTAATAAGAGTGCACGATAGCGCACGGAGTGAGGGGATGTTAGAG GGTGAGAGGCGTGTAATAGAGGAAGAATGCGTAGTTGTTAAAGTTAGAGA TCAGAACAGTAATGTATTACTAGAGTGGGAGAAAGAGAATAGTGCATCTC GAATATAGGAATTTGCAAGGACGTAGACAATAAAACGAGGAAATAGAAAA GTTATGAAGAAAATTGAGGGGGGCTGGGGGGCTGTGGTGGTATAATGGAT CATAAAGAAGGATGTGATGCGGATGTGAATCTGTGATATGTTATTAGATT CGGGTAAGGATGTATGAAGAGCTGGGAGTAGATCGTTTGATACACTGGGG AGAGGTAGTCGAGTGATGTGGGGGGCATTCTGAGCTGTGGGTGTGAAAAT CCCCCAGAAAAGGGGGGAAATTATAGATCGCAAAAAAAATTCCATTTCTC TGAGAGCGTGGGGAATCTGGTCCTTAGTCGCCGTGCAGAAATATTTCTAG CGGATATTCAACCACGTGGGAAGGGGAGCAGATGAAGCCTATGAGAGCCA GAATTCTTATCTAATTCCAAAGGGGTTTCCGGCTTCTCCCAGATAGTTGA ATGAGACTGACTGGCATCAATACGAGGAAGACTCTCTAAAAAATTTAGCA AAATAGCCTTAGTTAACCAGAAAATGGTACTTTAAAACTTACATTGCTGG CTTCACTATTTCTCCCCAGTATAGAAAGAGGGGAAGGAGCAAGGGGATAA CACAATATAGGTTTGCATGAAAGACCAGGTCAGGATGGTACTGGGATGCC TGTAAGGTCTCAGATGACCTTCTGTCTGTGCTTTTATTTCCCAAAGGCTG TTATAAAATCTCCCCAGCAAGTATTCCTCTTAAATATGGCAGTAAATTTC ACACTTCAGAAAGAGCAGAGTTAGGTCTTGGGAGTAGAGAAAGCCAACTC CCATGGTTCATACAGCTCACAGTTGAGAAACAATTAATTAGAATGCCAGT GTCTACAACTACCCATGATTAACCCAGCCTCTCTCGGGTTCCCATCTTAG TCTCAGAAATACTATTCTTTACGTAAGAATTTAAAACGTCTGAGTATTGA ATCCAAGTAATCTTTATAGACAGATTTACAATATAACCAATATCTCAAAC TGCTCATTTTTCTCTTATAAAATCAGAACTGACCAACCAACTATTTAAAT GTCTACTGAATACCTACTAGGTGTCAAGGCACTATGCCAGGGCTCTGCAG ACACAGTAGTGCCTATCGAGTGAGGAAGACAGGTTACTCAACTACACATA CAATTATAAGCGTGCTAGGAAGGCACAAACAGGGGATGTGACAGGAAAGC CAGAAAGGCTGAGGAGATCAGGAATGAGATGTGAGCTGGAATGGCGCGGG TAGGGGGTTGGGGGGGAGTCGGGGAGAGGGGGGGGGGGGGGGGGNGGGGG GGGGGGGGGGGGNGGGGGGGNNNGGNGGGGGGGGGGGGGGGGGNGGGGGG GNGGGGGGGGGGGGGNGNGGGGGGGGGTTGNNGNGGGTGGGGGGGGGGGG GGGGGGGGGGGTTGTTTTATTTTGGGGGGCGTTGGGGGGTGTTGGGTGGT GTNTGCTTGGTTGTTGGGGNGTTTTTGTTGGGGTGTTTGGGTTGTTTTGG GGTTTGGTTGTTGTGTTTGTTTTTTGGTGGTGTTTTGTTTTGGTTTGTTT TGGGTGTGGTTGGTTGGGTTTGTTGTGTTTTGGGGTGTTTGTTGTGGTGG GGTGGTGGGTTTGGGTGGTGGGGTGGTGGGTGTGGGGTGTTTGTTGGTGG GGGTTGGTGGTTGGTGTGTGGTGTGGGTGGNTGTGTGTTGTGTTGTTTTT GTGGGGTGTTGGGTGGGGGTTTTTTGTGTTGGTGGTTGGTTTTGTTTTGT GTNTTTTGGTTGTGGGGTTTTTTGGGGNGTGTTTGTGGGTGTTTTTGNTG TGTTTTGTGTGTTGTGTTTTGTTTGTTTTTGTTTGTGTTGTTGTTTTGGT TTTTTTTGTGNTTGGTGTTGTG project fbnu AU 20040903 2389bp ATAATTATTAATAAGTGGAAATATTGATATCAATATGAGAAAAGCTATGA CGAGAGAATCTAGTGTTAGAAGTTAAACGAGATAAGAAAAGAATTCAATA TATTGAGTAAGGTAGGATATATAGTCAATAGAAGATGGTAGGTAATAGGG GAATTGATAGATGTATATTATTAGAGTAAGGATAATATACAAAGTACGGT AAGGTACTGTATTATATATTAGATGAAATGAGTATAATTTTATAAAATAT GAAGATTATTTCTAGAAGTGTGGAGGAGAAGCTTAGGGGAAATAGGCAGT GATGGATAGAAAGGGAGGTATAATAGAGTAGATTAATACTGAGAATCGAC AAGATGGAGGATAGATGAGCAAGAGAAGAAGGGTAATTAGGGTATAAGGG GCGAGAATGTTAGGGGAAGATACTAGTTTGTAATAACCGATGAGAAAAAT TATTCTGTGGACAAATATTGGCTTTAAGGAATGGTATCCCTGAAAGTTTA GAAAGGAAGAGGAAATGGGAAGACCCTATGCAATGGTTCTATGTCTGGGG ATATCCCCTGGCCAGAAGAACCCCAGTGTCCGGCGAATCCCGTGGGTTTC AAAGAGTCAGACGCCGCTAGACCTCGTGCACACATCTCTGACAATTTTAA ATGAATCCTTTTGTTAAAATTTTTTCATTTCGCATAAATGCTGTTTTCTC TGAATTTCTTTTCCTGGGATTCTGGTTTCTTTCATGTATATTCTTTGCTT TTGTAATCCTTTGTTGTCTGCTCACATTAAGGATGGGTTACCAAAATCCC AGTTAGAAGCAGTTGTGCTCTGTGGGCTCAGGTACGTGAGTGGACTTGTC TCTAAGAACTTCACTGCGGGGAACCTCTGGAGTCCCATCTTTAGGCCTGC CTTTTCGGGGTGGTCAGCAGTCTGGCACAACCAATTCCATTTGCCATATG GTTGCCACACTACAGTCCAAGGATTCATCCTTCTCTGTTCTGTCAGAAAC CACTCATCTAGCTTCCTAAAGTATTTCACTCTTGTCTCCTCTCCTGTTTT CCTGTCTTTGTGCATTTATGCCCTAAAAAACAAATCCCTTTGCTATAGTT TTAGTGTATTTTTAGTAGAGCAAAATTAGATACATGTGTTCAATCTACCA TTTTTACCCAGAAACTTTAAATATCTTTTAACTATTTGTAAAACAGTAGT TTAAAAATATGAACATTCAGATGTCCTACATTTCAAATTTTTGGTTTTGT CAAAACAGGCTAGTTGACATTGAATGATTTTATAACAGAGATAGGAAGTT GAACTTACAAATGTGTTCTAATAAGACATTGCTTGTGTCTGTTTTAGATA GTGAAGTTCTACAAAAGGCTTTGCTTGCAGAAGGGGGTTGGCTGGGTTTT TTTTTATAATTTTATGTACTTATTTTTATTTCTTTTGACTGTTCTGAGTC TTCATTGCTATGCAGGCTTTTCTCTAGTTGTGGCAAACGGGAACTACTCT CTAATTGTGGTGCACAGGCTTCTCATTGCAGTGGCTTCTCTTGTTGCAGA GTAGGGCCTCTAGGGCGTGTGGGCTTCAATAGTTGCAGCTCCCAGGCTGT AGAGCACAAGCTCAGTAGTTGTGGCGCGAGGGCTTTGTTGCTCCTTGGCA CGTAGGATCTTCCCGGACCAGGGATCGAACCGGTGTCTCCTGCATTGGCA GGCGGATTCTTAACCACTGAGCCACTAGGAAAGTCCCCAGCTGCTTTTTT AAATGTTTGCAAACATCTCTTTTGAGCTGGTGATCAATTAGTGTGACCCT TGAACTGTGGTGAAGGTTCTGCTATTGGCCTGCATGGGAGAGGGGCTTGG AGGAGGGAGCGTCCCAGCCTCAATGGTAAAGGGAATGAAATAGGGAAGAC TTGCCACCTGAGCAAAGAGAAAGAGTTCTTTCCTTATACCCTCCTGACTA ACTTCCAGTCCTTTGTGCTGTCTGCCCACAATCCCTCCACAGCCTTGAAC ATTATAGAACATTACATTTTTAAAAATCAGTTTGGGGGATGTCTCTGAAG CCTCTACTGAGCCTACACCCTGTAGAGCCTATGCTCCGCAACACGAGAAG CCATTGCAATAAGAAGCCCGTGCACTGCAACTAGAAAAAGGCTGTGTGTG GCAACAAAGACCCAGAGCAGTCAAAAATAAATGATTTTTAAAGTTTAAAA AAGTATATAAAAGTCTGCTTTGGGATTTCCTTTGTGGTCCAATGGCTAAG ACTCTGCACTGCCAAAGCAAGGGGCCTGGGTTTGATCCCTAGTTATTAGG GAACCCTAGAGGAGGCAATGGCACCCCACTCCAGTACTCTTGCCTGGAGA GTCCCCATTGATGAACTANNCTTACCCATTGATGCCCCC project fbnu AV 20040903 2358bp GGGGGGAATCACTGCAGTAGTTCATCATATCGAGCCAGATACCATGACAA AGAGTCATTTAATCCTTGCAACTACCTTTTGAGGCTATCATCCCTATTTT ACAGATAAAGAAACTCCCTTTAAGAGAGATCAAGTAACTTGACCACGGTT CCAAAAGATTAAATGGCAGGGGCAAGTCTGGAATCCAAGCTTTCTGACCC CAAAGAAGACTAAGCTTTCAACTACTCCACAAAGCAAGGATGATGGTACC ACAGGCATTTCTCACATTCAAATTCATTCCCCTGTTTTCTTTTTACCCCA ATTCTCAAACAATCCTGAAATCCTCAGCCAGCCAGGTGATCCCAAGGCTG GCCTGCTCTGCCTCACTTCCTAAAGGGATCTATGCTGGAAAATGAAGGCT GGGGAGGCACACCTTTCCGAAAGAGGGAGCAATCATCAAAAAGAAAGATA TTAGGGAGGCTGAGAGACCAGCTGATTCCCCTGTGGTCTACATCCACCAG CTGCCCTTCTTTAGCTGCCCCAAACAGCACCAGCCACACCCTCCCTGTTT TCGAGGCCATCCTAGTCCCCACTCCCCTGTACCAGCCTTATTATTCTTTC TGCTTCCCCAAAATATTAGAAAATATTTTCCACTGCTTCTAATCCTGCCA TCACCTCACACTCTCCTGATGAACAGAATGTTACTTCTGGTCTTCATCCT TCTTGGGTTCAGTTTCAACCTCTTTGTCTTATTTACAGTCTTCCCATCAC TCCAACAGGATTCCAGAGGCGCTGGCTAGCCTGCCCCAGCCTTGCTTTGT GCCTACCCTCCCCTCATGTCCCTGGGGACTTTCTGCAGCCCCAGCTGAAG ACCTAGCCTCCATCTTCATCCTTCTTTCCTTTGCTTCCCCAAGTCCTAGA ACCCATTCTCCTGAACTCTCTCCTCAAGCACCTCCCCATTTTAAGAGCAG AAAGAGATCTGGGATATCCTTCTTATGCATCTTCCTTTTTTTTTTTTTTT TAATCGATGGGAAATCTTAGGCCCAAAGAAAGGTAGTGAGTGACTTGCCC AAGGTCACACAGAGTTGTTACAGACTGTCTTGGCGGCAGAGCCAGGGTTG GGACAAAGGGGCTTCTGCTCTCCCCGTTTCTTGGACTACCCCGCACTGGG TGGGGGCCAGAAACGTCTCCTTCCTCAGGAGACAATACCCCCCTCCTCAC ATCAGTAGACTATGCGGGGAAACGAAGGACGGAGTCTCAAGAGGTCTTAG AGGGTATCCACGGCTTCCAAAGGGAGCAAGTAGTGAGTCTGAGAAAGGGG CCTGTCGCACGCCAAACATCCCAGGAGGGGAAACTGTGCACCCCCCCTTT CCCCTAGACCCATGGTTCCCACGTCTCTCGCCCTTCTGTTCTTTCCCGAC CTTTCTCCACAAACGCTCCCTTCACTTCATCCTTTCCCCTTCCTCACCCA GTCCCGCAACTCCAGTTCTCCTCAACACCCCCACTTACTTCTTTATCCTG CTATAACGAGACTGGTAGGGTCTTTACTATACGCCATAGAACTCACCACA GATTTCTAGGGATAGTAGCCCTAATGAAAATAAAAAGCGTTGATATTTCT AAAGGAATACAGCGCTTTTTTATCTTTTTTTTATTCTGTTATTGTTTATT TGTGTTGCTCTTCATCCTGGCTTATTTGTTTTGTTGTTTGTTGTTTTCCT TTATCTATCTATGTGCTGCGTATGATAGAAATGTATTTGTTTAGTAATTA TTCTGGATCCTTGTCACTTTCTTACTAGTTTTCCTTGTCTCCCCTCACCC CAGCGGGGCACATCTGTGTGCTCTCTTGCGCCCTGGCTCTTTGTACATTT GTCCCTGTGCTTTTTTTTTTTTATTTTTTTTCTTTTTTTCTATTTCTATC GGTTTCTTTTCTAAATTTGGTTCTTCTTTTCTATTTATCTTTCTTCTTTT TTCGTCTACCGTTTTAAATGTCATTTCTGGTTCTCCTTTAGTTTCTTGTT TTTTTTTTTTTCTATTCTGTATTCGCGCCACCTTTATTTTTTTTTTATTT TTTTTTTATATTTTTTTATTGTTTTCTTTTTTTATTTTTTTTCTCCCTTC TCCCTTTCTCTTCTTGTCCTTCTTCTTGTACCGCTTTCTGGGCTCTCTTA CTATTCTCTCTGGCTTTCGTAAGTTCTTCTGTGATTTAATTCCTCCTCTT TTTTTTCTTACTGTTATTTTCCCTTCTATTTTTTATTTATTATTTTATGT TGGTGATCTTTTTGGTCTTTTTTATCTTTTTTATTTTTTGTTCCTTTTTT GGTTTTCACCTCTTTTTTTCTTTTCTTTTTTATTAGTTCCGTTACTTTAT CTTTACCT project fbnu AW 20040903 2285bp GGGGCATCGATGGTACGTAGTTCATCAAGCACGAAAATGGTAAAGATGGT

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnu.fa (2013-03-31)
    Open archived version from archive


  • GGAAGTTGAGGAAAGCTTTTCCTGAAGATCTCAATTTCTAGGTGAAACAG GAAAGGGACAGATTGGGGAAGAACTTAAAGAAAGTTGAGAAGATTTGAAA TATTCATTGGGATTGTAAGGAAGGAAAAACTTCTACTCTCTTAGGTTCAT TCATTGATTCTTATGAATTAAACCCACAAAAGACATAATAGCAAGAGAAA AGACAGATTTTTATTCACACACACACAGAAGTTCACAGGAAGGTGATTAG AATTTGGAGCTTATATACTATCTTATAGGGGAAGGGGAGCCGGAGAAGGG AAGACTTCTGGGGGTAATAAATGGGCCCTTTGGTGACTAGATGGCAGATA TAAGAGTTTTATGACGTCTGCTTAGATGATCTCTTATCTTGGTACCAATT TCTCTTCTCCAGTGCTAAGAGTCAATCTTGTCTAAGGGAAAGGGATTTAT GACAACGGAGTGCTTTTGGGAGGCTCTGCTTTCAGGCAGATAAGCAGAGT TCAGAAAAATATCTCTTCCTGAATCTGTTGATTCTCAAATACCTTTAGCT CAAGATAATTTTTATGAAAAGTGGCATATTCTGGACCCCTACATGGAAAA TAAGATAAAGATATAACTAGGGAAATGTAGAGATTTTTCAAATTGAAGAA AACAATATGTTTGTACATTTGTGTACTTTTTCCCTGGCAGGACCCAGCAG GGCAGATGTAGGAGCAGAGAAAGTGGACCCATGTTTCATTTCTCCACATT GGTGGGATGGGAGGACCAGTGGTTAAGGGAGTTCAAGGTGCTCTTTAGCC TGGGAGTGGATGACTATTCACTTAGCAACTATTGGAAACAAGATGGTGTT GTGGCCTGAATGCTTGTGCTCTCTACCCCCAGATTCATACGTTGAAGCCC TAATGCCCATGAGGCTGTATTTGGAAACAGAATCTCTGATGATGTGATTA AGATGTGATGAGGCCATAAGATGCTTCCTCCTTGGGAGAAAAGCCATGAC AAACCTAGACAGCGTATTAAAAAGCAGACATCACTTTGCTGACAAAGGTT CATTGTCAAAGCTACGTTTTTTTCAGTAGTCATGTATGGATGTGAGAATT GGACCATACAGAAGGCTGAGTGCTGAAGAATTGATGCTTTTGAACTATGG TGCTGGAGAAGACTTGAGAGTCCCTTGGACAGCAAGGAGATCAAACCAGT CAATCCTAAAGGAAATCAGCCCTGAATATTCACTGGAAGGACTGATGCTG AAGCTGAAACTCCAATACTCTGCCCACCTGATGAGAAGAGCTGACTCACT GGAAAAGACCCTGATGCTGGGAAAGATTGAGGGCAGGAGGAGAAGGGGAC AACAGAAGATGAGCTGGTTGGATGGCATCATCAACTCAATGGACATGAGT TTGAGCAAACTCCAGAAGATACTGAAGGACAGGGAAGCCTGGCATGCTGC AGTCCATGGGGTCGCAAAGAGTCAGATATCACTGAGCAACTGAACAACAA TAGGCCATAAGATAATCCTTATCTGATAGGATTAGTGTCCTTATAAAAAG AGACACCAGAGAGCTGTCTCTCAGGCACACACAAGGAAAGTCCTTGTCCT TTCATGTGAGGACGGATGAGAAGGCAGCCATCCACAAGCCAGGAAGAGAG CTCTCTCCTGAAACTAAATCAGCCAAAACCTCGATCACGGACTTCCAACC TTTAGAACTGTGAGAAAATAAGTTTCTGTTGTTTAAAACACCTAGTTTAG GGCTTTTGTAATGACTGCGGTAGCAGACTAATTCCCATGGACAGGGAAAG AAGTGCAGACAGTTAGGCAAAAGAGTGGAGAAACTCTTAAGGGTGTTGAG GAACAAAGCAATGGCTGCAGTGAGGAAAGGAACCTGCGGGAGGGAGTGTC TGTTAGAATTTGTTAACTGTCGAGGAATAGCAGCTCCAGGGATGACAAGC TCTAGGATTGTAGCTAAATGGTAGTAGAAGAAATGGGGTTGTGACCGCTA AGAACTGTGAGGCTAAGGCTTGGAGGTCATCTATGTGGACTCAGAAGTCC CCTAGGCTGATGACAGGACCTGAGATGAGAAGCATGTATGAGTTAAGAAG AGAAAAATGCTTGCTGCTGTAGTAAGAATCCTCACATTTCTGTGACTTCG CTGAATAAAAGTTTGTTTCTCTCTCATGTCACAGTCCAGTTTGGGTCAGG CAGCTCTCCTGACAGCTCTGCTCCAAGCAGAGTCTCAGAGATGGGGACAC AGCTGTGGTGGTCATTCGTTTCCAACAAGTATCGCCTGATACAAAATGTA GAAAAGATACCACGTGCACACACACACACACACACCAGCATCTCACTTAT GAATATGGATGAAAATATTTAAATATAATGCCAGCAGTAATAAAAGAAAA ATGCAGCATGACCCAGCAGAGTTTATTTTAGGAGTGAAAGAGAGAGGGTC TATCTACATGGATGGAATGGAAACATTTGCTTTGTTCAACCTTCTGTATC TCATCCAAACACTTGTATATCATAAAGTCAGAAATAGTGGCCCTCCACTT CAGCAACCAACAATGACATAAATCTGTGAAGACACTTCTCTCAACTGAAA TGCACTCTGTAAGGAACTTCTGAGCACAGAGGACCCCAGGCTGGGTGTTG TTTAGGACAAGACGTTTAAGACAAGGTTTCTCTTCTAGAAAGCTAAGAAA AGATGAAAACAACATCAAGTGTAAAGGCCCAGCAGTCAGACAGACCATGT TTAGAGTTGAGAGGGAGAGAAGATAATCTCCAGGCCTTGTCTGTTGCAGA GAAACCAAATCATTGCATTTTTCTCTCTGGGGGCCCTGGGAGGCTGCCTT TCCCAGCCCCTGCTGCTTCTGGGGAGGAGTCAGATAAGAGCTCTGGTCCC TGGACCAAGGGCAGGACTGATACATGCCACTATTAACTTTGGCCCTTAAG TGTTCTTCAGGGTCCCACTCTCTCTCCCCTATTTGTGCAAAGAATAAACA AATGTCAGTCGTCACACACACACACACCAGAAGAAAAAAAAGCCAAATAG TTTTCCAATCTCCTATTTAAAAAAAAAAAAAATTTGTTTATTTGGCTGTG TCAGGTCTTAGTTGCGACACGCATCTTTGATCTTCATTGCAGCATCCACN ATCTTTACCTTCAGCATATGAACTCTCAGTTGTGATGTGTGGGCTCTAGT TCCCCGACCAGGGATCAAACCTGGGCCCCCTGCATTGGGAGAGCAGAATC TTAGCCACTGGACCAGCAGGGACGTCCCCCTGCCCCTCCTATTTTCTTAA TCTATTCATTCATTTAAACAGTGTTTGTTATTTGCCCATTATATGTTAGG AGCTGTACTCTCATGGAGCTTACATTCTAAGATGACTGGTAAATTGTAGG AGTTTTTCCATTTTATTTTGTTATTCAGAAGTCCCTTATTGGATTTATTA ATTCAGTTTTCTAATTACTTAATATCACTCTTCAGCCTGACTGCTTTATT GTTCCCTCCTTGCCTTAAGATTGTTTTGTAGATTTTTAAAAAATTCCATA TATTGGCTAATTTTTCATCTCCTCTTGTTTAATAATAACAGTATTTAAGG GTGCACATGAAATCATTTCATGCACACATTTAAAGTTTGTTAAATTAACT GAATACCCATGAATGAATATTCCTCAGTATTACCAATCCTATGACTCACA TAGAGGATGCAGTCAAGTCAGAAAACTGTCTGCAGGAGTTCCAAAACTTA GGCATAGAACACGTGAATGATTTTAACATTTTCTCAACTATTGACAAAGG AATGAAAAGCACTGTTTGTTTTTAAAAAATCAATATGATCAATACACTCC ATAAGTGATTATAGATTTTATCAAGATGTATGTGGGTCTCGCTTTCATTT TAGAGCCAATTCTCTATATTTATTTACTTATAAGCAGTCCCTTATAGCTC AGTCGGTAAAGATTCTGCCTGCAATGCAGGAAATTTGGGTTCAATTCCTG GGTTGGGAGGAATCCCCTGGAGAAGGAAATGGCAACCCACTCCAGTATTC TTGCCTGGAGAATCCCATGGACAGAGGAGCCTGGCAGATTACAGTCCATG GGGTTGCAAAGATTTGGACAGGACTGAGCAACTAACACTTTCACTTCTTA ATGCATCTTTATCCACTCAGACTGCTAATATAAAGTCTAGTAGGAATGCA TCACAATCAGTGTGCTACAGAACACTCCTGGCCCGCCTGTGCTTATATCA CCCAACCCTCGTTCCCTCTCAACAACAACAACAGAAAGTGCGGAAACAAT AACCGGCTTGCTTTTGATGAAGCTTAACTGGTAAGAGTCAAAGAGCTGAG GTCACTGGGAGAGCTGGGCAGTGCACATAGTGAGTACTTAGTACTTTTTA GTGAATTAACCAAACAATTGCATTCTGACTTCAAGTCACCCGCTCCTACT TCATGCCCTCACAGCTGTGAGGCTCAAGTGAGAAACACATGGAAGAGCTT GGCAAGCTGCCACGTTAGTACCACTATTATGGTTTTAATGTTCCGTATTG TGACCCTAAAGCGTAATGCTCGACAGCACCACCAGAGGGCGGCAGACCCA CTCTACTGCTCTGAAAAAATATTCCATGGGAGTATCCAGGGAAGAGTACA GGAGCGGGTTGCCATATCCTTCTCCTTGAAAAACCTCACTGAATACGTTT TATATGGAAAAGGAAATACTCTTGTTCTAGCAAAAGCTTACCAAAATAAC CTTGTTCTTGGTACTCTGCAAGATCCCCTCACCTTTCAGCTCATTTCAGT ACAGCCGGCCAATGGCGTCCGACTCTGTGTGACCCCAGGGACTGCAACAT GCCAGGCTTCCCTGTCCAGCATCCACTCCCAGATCTCGCTCAAATTCTGT CGAGGAGTCTGTGAGGCTATCCAATCATCGTACCCTCTGTCTTCCCCGTC TCTTCCTGCCATAGGACTTTCCTAAAAAGAGAGGCGTTTTCCACGAGCCA GTCCTCCCCACCAGGGGGTGGAAAAGGGGTAAGAAAGAAAGGCAATTAAG GGTCTCACCCCTTTCCCGGACCAACGAAAGGGGGTGGAAAAAACGGTTAA TTCCTCCCTTAAAGGTAAAAAAGCCTGGGAAAAAAAAAAAAGTGGAAAAA AAGGGCCGGAAAAAAAAAAAAAAAAAGAGGGGGGCCCTTGGGGTCCCCCC ACCAATTTTTAGAAAAAAAAAACCCCCCCGGAAACAAAGAACCCCATGAA AAAAAA project fbnv AG 20040903 7294bp GGGGGGGGGTTGCTGCAGTAGTTCTCAACTCTAGTTCTTCTCTTTCTGCA TGAGGATGGTGTCATCTGCATATCTGTATATTATTGATGTTTCTCCTGGC AATCTTGATTCAAGCTCATGCTTCCTCCAGCCCAGCATTTCTCCTGATGT ACTCTGCGTATAAGTTAAATAAGCAGGTGACAATATACAGCCTCCCTATT TGGAACCAGTCTGTTGTTCCATGTCTAGTTCTAACTGTTGCTTTCTGACC TGCATACTAAACTCAATATCTTATAATAATCTATAATGGGAAAGAATATG AAAAAGAATAGATATGTATATGTATAACTGAATCACATTCTTGTATACCT GAAACTAATATAACATTGTAAATCAACTATATGTCAATATAAAAACTCAC ACCGGGGGGAGGGGATATATGTATCAGTTCAGTTCAGTCGCTCAGTTGTG TCTGACTCTTTGCAACCCCGTGAATTGCAGCATGCCAGGCTTCCCTGTCC ATCACCAACTCCCAGAGTTCACACATATGGCTAATTCAAATTGCTCTATC ACAGAAACCAACACAACATTGTAAAGCAATTATCCTCCAATTAAAAATGA AAATTAAAAGTTTAACCTTGGGGAGAAAGTATCTGAAAGACTGAGAGGAT GGAAGCTCAGAGACACCTAAAACAGAGGGAGGAAGAGTACAGAGGGTGGG GACAGCAGCCAAGGGGAGCCGAGAGAATGGCTCTGCCTCCCGGAAACAGA GAGGCCTGCCTTGTGCATGTCTGGTGACTACGCCAGTCAGCAATCCACGT TCCCTTCCCTTCCTCTTCCTCCTTGGAAAAGAACTTGAGGATAAAATTTA GACGGAGTTGGCATAAGTGAAATAGGACCATGAAACTGATTCAGAAAACT GTAAAGAGATCAGTTTGTGTGGATAGAAAGCCTTCAAAATGTTTGGTTAT GAACAGGAGAGACTATGGTTAGAGCTAGGGGAAAATGCATAGGTCACAGG AAGAGGTTTTTATGGTGGTTTTTCTTTTTAAAGCAGTGGTGATGCTTTTC AAACAGCACAGCCTTGAAGGTGTTGAAACATCCGTGAAAAGAGTAGTGGC AGAGAGCTTCCTAGCCAGTGTTCATACTCTAGGCTTCCCTCTCTTTCATC CATCTTGGTTATTTCATATGAGCTAATTTTTCTAAAACTCTGCAGGTCCT CAGCACACATCGTCCTCTGTTGTTGTTACACCTTTGCTCTTGCCCTTTCT GGTATTGNNNNTNTTTTCTTCNCCTGTCTNCGCCTNNNNNTGCCCGTGNN CTTTTGNCTGTCTTTCNNNTGNNNCTCTCTCTTNCCTTTTTCTTGGNNNN CCNNTNCTTNNNCTTNTTTCTTNTTTNTTTNTTTTCTTCNTNTTCTNNCC CCCTNTNTTNNTTCTTCCTCCCNNNNNNTTNTCCCTTTTCCTNNCCCCCT TTNTTNNNCCNTCNTCTNTNTCCTCNCCTCCCNCTCNCCNCCTTCTNNCT NCTNCNCCCCCCCCCCCCCTNNNNNCNCCTTTNNNNGNTCTCCCCCCTNC TCTTTNTTNTCNNTCCCNNNNCTNCTTTNCCNNNCTTCNCCCTNCNTCNN NTTTCNNCCNCCNTTNNCTCTCTNNNCCNNNNCTTTCCCTCCNNCCTTCT CNTCTCTTNNTTTCNNTNNCCCTTCTTCTTCTTNNCTTTCTTCCTNTCTT TCCCTCCTTNTCTTCCCNTCNNTNTCNCCTTCCNNNCTCCCNCCCNNCTT TTTTTCCTCTTCTAGATCTNCTTCCTCTNTNTCCCTTCCNCNTCNNTNTC NTCCNCCNCNTCTTTCTCTTCNNCCCNGTCCTCTAAAGGGCCTTCCNNNC NNTNNNTNTCNCTNTCTCTGGCCCTTATGGCTGGACATCACCATCATACT TTAAATTTACTATGTCCAAGACCAAACTCCTCCCCAGTGCTTTACCCCTT CTCCTCTAAACCTTGTCATCATAAACCGCTCTGTCCTCCATGCTTTGCTA TCTCAGTGAATTAATCTATCTGTCATCTAGTTTTTTAAATCAGAGTTTGA CCTGAGCATCATCCTTGATTACCAAAGGATGAGTCAGTTTGGGTTCCTTG GAGAGTAGTGCTGCCCTTAACAGTGCCTGATACTTTCAGGAGAAGTTTAA CTCTTTTTTTTTTTTTTTTCAATTTTTTTGGAAAGAACAAGGAAAGAGTG ATTTATGTGGATTAGAGAGGTTGAATTTGAAGTCACTGGGATGCCTATGT AAAAAATATTGATTGGGCATTAGGAAATGTAGGTACTGGATTAATGAAGA GATTTCAGAGCTAGAGTTACACATTTGCCAGTTATCTACAGTACACAGAG ACAATAATTGAAACCATGTGAGAGGATGAGATCATCATGGAAAAGAGTAC ATAGAAACAAGGATATGTGGAAACAAGTTGCCAGACCAGGTCACAACTCT GAAAGCTGACAGGACTTCACACATCATCTGGCACAACTTTTTTTTCACCT GAAAATTATACTAAGAGAGGAAGAGAGAAATTAAATTCCAAAGAAAAATC TGCTTATAAGGTCTGTGATGCCAAGTTACTTGAAAGAGCCAAAGCTCAAA GAAAAGATTCAGAAGGAGCTGACTCTGCTCAAAGTCAAAAGCAGTGACTC AGGATCAAGACAACATTGTTGCTGGAGCCAGAAAGAACTTGCATCTTTTA TGAATTCCAAGACCTAACAGATAAGCAAGCCCTAACTCACCCCGCCTCCA AATTTCCTGTTAAACCAATCTATTCCTTTATAGTGTAAGACTGTTTGGTT TGTCACTTACTGTTACTTCAGTTAATCCTGGAGCCAGTTCTCTAGAATTG AGTGGGCACATCTTTTCCCAACTCTGTATTCAGTGACATCATCTTGTTAG GTTAAAATTGGCCATCGTGGGACTATTTAAAACTCAAACATTGGCAAATG CTCTGAATTAGGGATTCCCACCACCACCATCCCTCAGTGGAAACCTGCTT GTTGAACATTTTCCTGTACATCACTGGTCACAGCCAAAAGTACTTTACTG ATACACATGTTGAACCAAAAACAGGATGAACAAAAAGAGGATGGTCTGAG GGGCCTAAAAGTTCCCCAAAAGGGGACCTAATAGGTGTGGACTGCCTGGG AAACAGGAGGATAAGGGTGGGAACTGATGTCGGCCAACCTACACTGTGTC TTCATCCAAGTCAATGAGCTGTGAGTGCCCTCTTGGAATGATGTTAGGAG TGTTGATCATACCACAAGAGTCAGCAATTGTGCATCTGCTATGGGAGGGA ACCAATCCAAGACTATGACAGTCCTAGTGCAGTTAGGATGGACCATCACT ATAATCTCTCTCCTTTTCCATCTGTTCCAACAGTGGAGGGGCCCGAAATG GCAGCTAGTGAGGGGTGAGGAGTTGGGACTAGAGGAAGCAAGAAAGAGAT CCACCTCAGTCTCTTAACCCTGCAGATTTCCCAGCCTTGATGAGAGAGGC AGAGGCTTTAAAGGGAACAAATGATGGACATTCCAAAGTTAGATCAGAAG ATGCTTTTTCAATCTACAGTATGAAATTACTCTTATGATTCCACAGTATG AAATTACTCTTATGATTCCCAGAGACTAGAAAAGCTGTGGAGTATGCTTG GTATTTCCTCCAGGGGCAGGAAAGAACCTGCAAGAGGAGGTTTGAAGGGT CCTTCGGGGAAAACAATAAGGAAAATTTCTCTTTGTGTCCTACTGGCTAA CTTAATAAACAGCTTTGCACAGATGATTGCAACACTTAAAAACCTTATTA ACTATACGGAAGCACAGTAAATATGGTTAATTGATGTCTATTGAAGGAAT GAATAAAACTCTTAACTTACAAGAAGAGAAAAAGATTTAGGAGAAATTCT TCCATCCGAGCAAAATTAGAAATTGTTTGAGTCTATGTCATGTCAGAAAG AAAAGTACTTTCTTGTAATTCTTCGTATTAAACCAAGTTCTATTTCATAG ATTCATTGGAAAGTGATAGTTTGTGGATATTTACATTTTTTTTTTGTCTT TTAACTCTCATAAAACTAAAGACAAACACAAAATTTCTGTCTCACTTCTC AACCTCTGCCCTGTGCAAAGAGAAGAAAAAGATTCCTTTCTGTCTTTTGA TGGTTCTGCTTTTCTCCATAGGCAATGAGGGCTGTGGTCGTGATCTGGAC TTCTAACTTTTCATGGGGAGAATTAGAATGCATAGGATCTTAGGATCTAG CAGCCCTGGATCTTCAGTTTCCAAATAACCACTAGATGCAGGTGGTTACT TAATTATAAATTAGTTGAAATTAAATAGAATTAAAAACTCAGCATGTTTT AAGTGTTCATTAGCTACAGTCAGCTAGTGGCACAGATTTAGAATATTTTT TTAATCATCACAGAGAATTCCACTGGACAGCATTGCCCTAGCTCTTCATT ATAGAAAGACAAAATATTTTTGAGATAAATTTTTACCTAATGTGATTCAG ATCCATTCCAAAAAGCTTTCATATTTAAACCAGTCAAGAAAGGAAATAAA ATAATCTTCAAATAAAGAATTTGGAGTACAGCTAAAAACAGACTTTGATG GAAGTGGTCTTTTGTGTGTACATTTCATTAAAATGCTTTCAGTGTGACTG TTTGGATAATTTTGTTATACTGCATTATAATGTTACAGTATGTCTTCTGG GATCATTCCCAGAGTTCATCTCAGTTTTTGTAAAGCATTACATAGCTATT TGATAATGGCAAAGAAAAATTAAAATTGTCTGCAATTAGAAAGGAGTCTT TACATTCTCCATGACTAAAATCTTTGGACAAATCCAAGCAAATTAGATTG ATCTTTACCAGGGATAAGAAGATTGCTTAGTTCCCCTCTCTGAATGCCAA ATATAATTTATAACAGTTTCACTTCCAACTCACAGCTGATGACTGGGGAA AAACTATTAGATTAGAAGAGGACTCATTGGATTTAACATATCAGTTCAGT TCAGTTCAGTTCAGTCACTCAGTCATGTCCGACTCTTTGCGACCCCATGA ATCGCAGCACACCAGACCTCCCTGTCCATCACCAACTCCCGGAGTTCACT CAGACTCACGTCCATCAAGTCAGTGATGCCATCCAGCCATTTCATCCTCT GTCGTCCCCTTCATATGGATTTAACATATGGTAATTTCAATAAAAGCTCA TTATAATGAAGTATGTGCATGCGTACATGCTAAGTTGCTTCAGTCGTGTC TGACTATTTGTGACCCTATGGACTGTAGCCCATCAGGCTCCTCTGTCCAC AGTATTCTCCAGGAAAGAATACTGGAGTGGGTTGTCATGCCCTCCTCCAG GAGATCTTCCCAACCCAGGAATCGAACCTTCAACTCCTGCATTGCAGGTG GATTCTTTACTGCTGAGCCACAGGGGAAGCCCATGATGAAGTATAATTGT AACAAGTTTCCATAGCATAAGAATTACCAATGGGAGAGGGCAAGAATAGA TAAGAGAAAGAACTGTAAAATTGTCATTTCCTTGGGAATGAAGATAGACT CCTTGAGAGCAGACATCTTTGTTCTGCTATTGGTGTCTTGGAGCCCAAAA TCCTGCCTGACACATAGCAAATGTTCAGTATTCATCTTCTTCTTAACAAG GTCTATGAGCAAAAGAAATTATTTTTACCAGAGTTTACATTATTGGGGTT TTAGCAGAGCTTAACCGATCTGAGGAAAGAGAAATATTCAACTCTAGTCT TGCATGTGAGAGAAAGGAAATAACCAATTACAGCCCAGTTTAGCCATCCT GTACCACCTAAGAGATGGTGGGAAATGGACATAGACTTGTGAAGTTCACA GTTCAGGGGTACAGGCTCATTAAAAGATTGCTGCCCTTCCCCCACACTTT ACCACCACAGCACCAAAGAACAGTACGTCATGTCTGTTTTTCACAATTAC AAGGAATATTAAAAGGTAAAAACAGTTTGAAGAGACAGGCCAAGCATGAG AACCAGGCTCAGATATGGCAGCGATGTCAGACTTAGGCCAAGAATTTAAA ACAACTATGATTAATATGCTAAGGCCTCTAATGGCTAGAGTGAATAACAT GTAAGAACAGATGGAGAGTGTAGGCAGAGGGATGGAAATTCTAAGAAATC TGTGAATAGAAACTTCCAAAATGAAGATGTAAAAAGAAAAAAGACTGGAA TAAAAATAGAATATTCAAGAACTGTGGGCCAACTACAAAAGGTGTAACAT ACTTAACAACGAAAATATCAAGAGAAAAAAGAGAAGGGGGAACAGAAATA TTTGAAGCAATAAAAACTGAGAATTTCCCCCCAGTTAATGTCAAGATTGC CGGCAGAAATATCAATAACCTCAGATATGCAGATGACACCATCCTTGTGG CAGAAAGTGAAGAGGAACTAAAAAGCCTCTTGATGAAAGTGAAAGTGGAG AGTGAAAAAGTTGGCTTAAAACTCAACATTCAGAAAATGAAGATCATGGC ATCTGGTCCCATCACTTCATGGGAAATAGATGGGGAAACAGTGGAAACAG TGTCAGACTTTATTTTGGGGGGCTCCAAAATCACCGCAGATGGTGACTGC AGCCACAAAATTAAAAGACGCTTACGCCTTGGAAGAAAAGTTATGACCAA CCTAGATAGCATATTGAAAAGCAGAGACATTACTTTGCCAACAAGGTTCG TCTAGTCAAGGCTATGGTTTTTCCTGTGGTCATGTATGGATGTGAGAGTT GGACTGTGAAGAAGGCTGAGCGCCCAAGAATTGATGCTTTTGAACTGTGG TGTTGGAGAAGACTCTTGAGAGTCCCTTGGACTGCAAGGAGATCCAACCA GTCCATTCTGAAGGAGATCAGCCCTGGGATTTCTTTAGAAGGAATGATGC TAAAGCTGAAACTCCAGTACTTTGGCCACCTCATGCGAAGAGTTGACTCA TTGGAAAAGACTCTGATGCTGGGAGGGATTGGGGGCAGGAGGAGAAGGGG ATGACAGAGGATGAGATGGCTGGATGGCATCACTGACTCGATGGACATGA GTCTGAGTGAAGTCTGGGAGTTGATGATGGACAGGGAGGCCTGGCATGCT GCAATTAATGGGGTCGCAAAGAGTCGGACACAACTGAGCGACTGAACTGA ACTGAACTGAATGTCAAATATCAAATGAAGGATCCAGGAAATTCAGAGGA GAATAAATGCCTAAATCAATGCACTGATATATATATTAAATTCAAANTTA CAANAAATAAAAAATAAAATGAGAACTACGTCCATCGATGCCCC project fbnv AH 20040903 6414bp CATTTTGTGGGGGTTACAGGAAAAAAAACAAAAGAGAGTTTCCAGAAAAA CATTTTTTTTTTTTGTTTTGATTTATTTAGAAAAAGCCTTTGACTTGTTG GGGATCCCCAACAAACTGGGGAAAATTCTGAAAGAGATGGGAATACCAGA CCACTTGACCTGCTTCTTGAGAAACCTATATGCAGTTCAGGAAGCAACAG TTAGAATTGGACATGGAACAACAGACTGGCTCCAAATAGGAAAAGGAGTA CGTCAAGGCTGTACATACATCACCCTGCTTATTTAACTTCTATGCAGAGT ACATCATGGAAAATGCCAAGTTGGATGAAGCACAAGCTGAAATCAAGATT GCCAGGAGAAATATCAATAACCTCAGATATGCAGATGACATCACCCTTAT GGCAGAAAGTGAAGACGAACTAAAAAGCCTCTTGATGAAAGTGAAAGAGG AGAGTGAAAAAGTTGACTTAATGCTCAACATTCAGAAAATGAAGATCATT GCATCCAATCCCATCACTTCATGGCAAATAGATGGGGAAACAGTGGCTGA CTTTATTTTTCTAGGCTCCAAAATCACTTCAGATGGTGATTGCAGCCATG AAATTAAAAGATGCTTACTCCTTGGAATAAAAGTTATGACCAACCTAGAC AATGCCAACAAAGGTCCGTCTAGTCAAGGCTATGGTTTTTCCAGTAGTCA TGTATGGATGTGAGAGTTGGACTATAAAGAAAGCTGAGCTCAGAAGAATT GATGCTTTTGAACTGTGGTGCTGGAGAAGACTCTTGAGAGTCCCTTGGAC AGCAAGGAGATCCAACCAGTTCATCCTAAAGGAGATCAGTCCTGGGTGTT CATTGGAAGGACTGATTTAGAAGCTGAAATTCCAGTACTTTGGCCACTTA ATGTGAAGAGCTGACTCATTTGAAAAGACCCTGATGCTGGGAAAGATTGA AGGTGGGAGGAGAAGGGGATGACAGAGGATGAGATGGTTGGATGGCATCA CCGACTCAATGGACATGGATTTGGGTGGACTTCAGGAGTTGGTGATGGAC AGGGAGGCCTGGCGTGCTACGGTTCATGGGGTTGCAAAGATTCAGACATG ACTGAGTGACTGAACTGAAGTTACAATAGAGAGATTTAGAAAGTCCTATG AAAATCATGGGCAAATCTGAGTTGTGCAAGCCCAAGCAATGGCAAGAAGT GGATTTATCCAGTCTACATGGCTAGTGTATTCATATTATAGAGATGGATA TGATGGTTGTCAGAGTTTATGCTTGCTGTATATCCTATTCATACAACTAA TTCCCCTTGTTCTGTTTTATTTTCCCCAAAGTAAATTTCTTAGTGTATTT TGTCTTGATCACACTGGACTTGAATANTTACATTTCCTTGATGGTTACAT TTCCCTTTAAAATCTAATAGATTAGCATTCTGTGTTTCTACTTCATGATC TTTTTAGTTTTGTCAGCATAAGGTATATCTCTAAGTTCAAGGAACTCTGG GTTTTTGACAGGTCTCAGAGCCCACAGATCTGAGGTCATTCCCTGGCAAG TGCTAAATTCATTACCTGAGACAGTCTCGTCATGTGGACCTTGTGAGGGC AGCCAGCCAGCACTCTCCTGGCAATGCCACTGTCTCCTCCATGCACCTCC TCACTGCCTTTCAGCCAGATTCAGGAGAGATGCCATCACTACCATATTCT TTTCCTCGGAGAGTCCTTCATAGACTCCATTTGACAGTCATTCCTCCTCC AGTAAGGCCTTGTAGTGCCTAACTCCACCGATAGATAATGACCCCACTCT ATGATAGAAGAAGGGATGTAATCGTATCTAAATCAGAGAGAGAGGGAAAA GCAACCAGTCAACCCAGTGGACAACCCACCACTCTGTGAATGAATAGGAA TGAATGATTGTAACACTTTTTCCTGGAAGTTTTGTGTGCATGGATAATAA GTAGACTCTTGTTCTTTTATATAATGCTTTATTTCAGAGAACTCACCCAC CTCAAGATTTCTCACTTAACCCTCAGGCTTTCCTGGCTAACCCCATTCCA TAGGTGTCACACCAAATTCATCTTTAGAGCTAAGAAATTCAACCAGACAG TGCACTTTCTCTCAAGAAAAAATTGTGACAAGGACCTTTGTGAATTCTTT GTTTCATTAGATTTATCATCCACATTTAGCTTTCTGTACATGACCAGAAA ATATTTTAAAATATTAAATGCTCAAATTAGTGTCAGACATTCAAATGTGA AGTCAACATAAGTCCCATGCCTCTTGGTAGTTAATGTAACATTGCCTTAA TAATACACAAGCCTAGAAGAAAAAATATGTTTATTTAAGTAAAAGCAGTT TTTAAAACATGTCATCTAGTGGATCAAACTTTCTGATTTCAAAATTTCAA CATCCATCAATCATTACTGGTTGTCCTTTTAGCTGCTGAAGGGACTGTAT TTTTATAATTGACTACTGACGTGATTGATTGGGAGGGGGGATGGGGAATA TTTAAAAAATATAAAATCTACTGAATTCAAGTAATGTTACTTTGTGACAC TTCAAGGCCTAGTATCTCAGAAACAAGCTCAGTCAGTTCAGTCGCTCAGT CACGTCCAACTTTGTGACCCCATGAATCACAGCACGCCAGGCCTCCCTGT CCATCACCAACTCATGGAGTTTACTCAAACTCAAGCTAAATCTATGCAAA TTCACTTCATAATCAAAGAAATTAAGTATATGGTTAAGAGTGGAACTCGT ATGTGCCACCATGAGGCCAGCATTGTGTGATATACAGAGGAGCTTCAAGT ATTTCACAGAACAGGGACCCAAGAAAGAGATGGGATAACTGGGGACACTG CCAGCCCTAAAGGCAGTGGTAGTCTGCCTTCTGGGACTGGAATTCATTTC TATTTCTACCACCCTCAGCTGCCCTCCAGTCAACCCTGCATCACCTCTTG CAAAGTGATTGGCATGAATAATTAGAGACATAGAGATGAAAGGGATGTAG AGACTGCAAACTATAGTCCCTCCATTTTCTTTTACAAAATGTATGCCAAA ATAAGTCTTTAGGAATCAGAATCTTTTCCTATTTTTTCCTCAAAAGCGTG ATTGAAGGATCAGCAATTTTTAAGTTTTTTGGAAGTCATAGTTTAGCAGC CTGGCCATAGCTCAGCCTGGCATGACTCTCTTCCCCTTTCTACTACCTGC ACCCCTGCAGTGACCTGTTTGTTTCTGGGAGTGGATGGGCTGATCACTTC CAACAACTAGTGGGTATGGCTTGTAAAAATAGCTATCCTGGACTTGTTGG CAATGTCTACATCTCAAGGAAGATGAGTAGTGATCTGAGTCAGCTGTTCA TGAAATTCAAGCAAGTGGACAGGGTGATTAATCAGGAAAGAGAATTGATG GTGACCAAAAGGTCCCCAGTGGCACCCCACTCCAGTACTCTTGCCTGGAA AATCCCATGGACAGAGGAGCCTGGTAGGCTGCAGTCCATGGGGTCGCTGA GGGTCGGACCCGACTGAGCGACTTCACTTTCACTTTTCACTTTCATGCAT TGGAGAAGGAAATGGCAACCCACTCCAGTGTTCTTGCCTGGAGAATCCCA GGGACAGGGAAGCCTGGTGGGCTGCCGTCTATGGGGTCGCACAGAGTCAG ACACGACTGAAGTGACTTAGCAGCAGCAGCAAAAGGTCCCCAGATAGCGA CATAATCTCAGTGAGGAAATGGAGATATAAATTGAGCAGAAAAATGTGCC CGCGAATTCCCCAACACCATGATTTTCAATATTATATTTTAAAAGATTAT ATTGATTATGTTTATCGTGGAATCTTCCCTGGTGGCTCAGACAGTAAAGA GTCTGTCTGCAGTGTGGACTTTGCATAAATAAAAATTCATAAACAGAAGG ATTAATTCAATGATTCATTTTTTTAATTGGAGGATAATTGCTTTGCAATA TTGTGTTGGTTTCCTCCATACAACAATGCAAATCAGCCGTAAGTATTAAT ATACATATATCCCTTCCCTCTTGAGCCTTCGTCCCACCCCTCCCACCATC CCACACCTCTAGGTCATCACAGAGCATGGAGCTGAGCTCCCTGTGCTATA TAGCAGCTTCCCACTAGCTATCTCTTTTACATATGGCAATGTATGTATTT CAATGCTACTCTCTCAGCTCGTCCCACCCTTCCTTCCCTAGCTATGTCCA CAAGTCCATCATCTATGTCTGCATCTCTATCCCTGCCCTGCAAATAGGCT CATCAGTGCCATTTAATTCAGTGGCTGTTAAACCTGGAAACTAGAGTAGT ATCAGTTCAATTCAGTTCAGTTCAGTCGCTCAGTCGTGTCCAACTCTTTG CGACCCCATGAATTGCAGCACTCCAGGCCTCCCTGTCCATCACCAACTCC CGGAGTTCACTCAAACTCATGTCCATCGAGTCAGTGATGCCATCCAGCCA TCTCATCCCCTGTCGTCCCCTTCTCCTCCTGCCCCCAATCCCTCACAGCA TCAGAGTCTTTTCCAATGAGTCAGCTCTTCGCATGAGGTGGCCAAAGTAC TGGAGTTTCAGCTTTAGCAACATTCCTTCCAAAGAAATCCCAGGGCTGAT CGCCTTCAGAATGGACTGGTTGGATCTCCTTGCAGTCCAAGGAACTCTCA AGAGTCTTCTCCAACACCACAGTTCAAAAGCATCAATTCTTCAGCGCTCA GCTTTCTTCACAGGGTAGTATAATTGTCCTCAAAAGTTCTCTCTGTTTCT GGGATTTAAGTTTTCGATAACAAACCACAGGCTTTTGGGAGAGTCTGCAG TTGGACCAGTGTATCGTTTCTATTCTAAAGCCAGAAAAATAAATTTTTTC TTTTCTGTCAGGATTTCGATCTATCCAGTAGATTTAACCACAACTTATGT GTAATCATTGTTAATAATCTTTCATCTATTTAATATCCATTTGGCTTAGA GATCAGAATATTGTATTTTTAAGAAATTAAAAGGAGTCAATTTAGTTTAA TACTACTGGTTATTTTTTACAGAACTGAATATATGTAATCATGTATCCCT GAGACCAATGTCTGGACGTGCGTGTGTGTGTGTGTGTCTTTGTGTTCAGT CACTAAGTTGTGTCCGACTCTTTATGATGCCATGGAATGCAGTACGCCAG GCTTCCCTGTCCTTCAGTATCTCCAGGAGTTTACTCAGATTCATGTCCAT TGAATTGGTGGTACCCACTGTGTATTCTCCTAGTTAGTGCCTAGCCAAAA AAGTGCAGGAGGTAGAAGAACAAAGATTATACCAATACCTGGAAAAGTGA CCCACGTAAAAGTGGAATATTTGTTACCAATAGTGCATTAGAAAGTTTCA ACATTTATGCCAAAGACTCTTCAGATTTGCAGATTAACTTCAATAATTAA TTGGTCTATGGGTGATGTTACTGCTTCTTAGTACTTTTTCATGCTTTAGT ATGTATCAGATACTCATCATAATCAATGATTTTAAAGTTCAAGAGGCGTA CCCATCTCTGCTCTGCAGGAAGAAGCAAGAGTGGAGGGGATTCTCCTCCA TTCCTTTACTGTCAGGGACAGACCTCACTGCTTCAAGGCACCCTTCTCAC AACCAGTGCACAACTAAGAGTAATTCAAGGTTCATAGAGTGATTTCATAC CTCAGCACCAACCGTGACATTTTTCAGGATAAAATTGAGGCACCAAGATC TGAAGTGCCTCTCCCTGGAGAACACAGCAAGGGATAGAGGTTGAGTTTAA ATCCAAGTCTTCCCAAGAGTCCAAGCCCTTTCCACAGTATCATTTAACAA GTTCCAAGCAGGAAGCGTTCATTTCTCAACAGACAGATACAAGGCAATGT ACAATCTAGGAATATAGATAAGGTCTTTCTCCTAAGGCCTAAAGAATATC TTTAACTGATGAGACTTCTAAAAATCAAAATTTTTTTTCTTAAATCTCCA GTTATTATTTATTAGGGGTAAAAAAAAAAAACTTTTAAATTAAAGATTAA AAAGAAAATAAAATCCATCCTAAAATAAAGAATTTTATAATAATGCATGC CAGTTTTTGAAAAAGTATTATAGCTGCTTTTGGAAACCAAAGTGAAAAAA AAATTAAATAGATAAGGTTTGAATTTATATATAATGCCGGTGAGACGAGA GGAGGCGTAACGGTTTTGTATCAGTCTTTGCCATAAGGTTTGAAATCATT GATATCTGCTTCCTCTGAGAGGGGCCTCCATACATCTCCCTGCTTTTCTA GTGACGTTTGCGAGTGACCGATAGACTAGTGTCCTGTCTAGACATCATCA ATTTGATACAGGAGCAATGGCTAAAGTTTGTGATTAGCTAAACCCTTGCG ATAGAAGAATTTAAATTTATTTGAATTTTATTAATTATATGTATCGATCG GTTTTTATTTGCAG project fbnv AI 20040903 6138bp TTTTGTATAGTTGTTCTGTATATTCTTGCCACCTCTTCTTAATATCTTCT GTTTCTGTTAGGTCCATACCATTTCTGTTCTTTATTGAGCCCATCTTTGC ATGAAATGTTCCCTTGGTTATCTCTAATTTTCTTAAAGAGATCTTTAGTC TTTCCCATTCTATTGTTTTCCTTTATTTCTTTGCATAGATCACTGAGGAA GGCTTTCTTATCTGTCCTTGCTATTCTTTGGAATGCTGCAGTGAAATGGA TATATCTTTCCTTTTCTCCTTTGCTTTTCTCTTCTCTTCTTTTCACAGCT ATTCCTCCTCAGACAGCCTTTTTGCTTTTTTGCATTTCTTTTTCTTGGGA ATGGTCTTGTTCCCTGTCTCCTATACAATGCCACGAACCTCCGTCCATAG TTCATCAGGCACTCTGTCTCTCAGATCTAGTCCCTTAAATCTATTTCTCA TTTCCACCGTATCATCATAAGGGATTTGATTTAGGTCATATCTGAATGGG TCTAGTTTCCCGGAAAGCCACCTGACAGTCAGGAGACTCAAGAGACTGGA CTTCGATCCTTTGGTGAGGAAGAGCCCCTGGAGTAGGAAATGGCAACCCT CTCCAGTATTGTTGCCTGGAAAATTCCATGGGCAGAAGAGCCTGGTGGGC TCCAGTCCATGGGGTCAAAAAGAGTCAGACATGACTGACGCAGTATTGCC TGCCTATCTTGTTGTGGTGGCTGACTAACTCCCCTGCTATTTGTCACTGA GAGTAGTCTCTATTTCTGTTCAGTTTGCAGTACCACACCCTTGGGGAGAA AGGAGTCAAACATCCCATACATCTCTTGAATTTAGGGCCGTTGCCAGGAT TCCTGCCAGGCAACGAAGCCTCTTCCCACAGAGTCCTAAAGATTTAGAGG AGATGGTAGCAGAGGCATTTATGGGAAGTTTTTCCTGGCTATGTTTTCAT CGCCTCTATTTATTTTTGGAGAATACTTAGAAAATGTGTTTTTATTTGCC CTCAGACCACGTTAAAGATAACTCCACTATGGAAACTTGCCCTCCAGCCC CAGCCCACTCTGTCTCTCTTAAAGGCATACTTGACCCCTAGAAAGTGCCA GGTGTGGATCACTTTACTATCTATGGGCATTTCCATGCAATGTGTTCATA TTTGGCCTAGAAATGCTTTCTGGGTTGTTGCATAAATGTGATTCTTCCCA TAGTCTTTCTCATTTCAGTCAAAGGCAACCCCATCCTTCCAATTGCTCAG CCCCCAAACTTGGTATCATGTTTGACTCCTCTTTGCTTTCATACTATAAA TCAGCATTCCCCAACCTTTTTGGCACCAGAGACTGGTTTTGTGGAAGACA AGTAAAGTGGCTCAGATAGTAAAGAATCTACCTGCAATGCAGGAGATTTG GCTTTGATCCCTGGGTCAGGAATATTCCCCTGGAGGAGGAAATGGCAACC CATTTCAGTATTCTTGTCTGGGAAATCTCATGGAGAGAGGTGCCTGGCAG GGTACAGTCCATGGGTCACAAAGGGTTGAACACGACTGAGCAACTAACAC ATGGGTGGGGGATGATATTAGGATGATTCGAGCACATTACATTTATTGAG ACTTTATTTCTAGTATTATCATATTGTGATAATTTGGTAATGCCAGCGAT GGGGAGCAACTGTAAATGCAGATGAGGCTTTGCTTGCTTACATCCTGCTG TGGGGTCCCAGTTTCTAACTGGTTCTGGGAATTGGGGATCACTTCCCTAG ATCTATACCATCAGGGGGAAAATGCCCTTGGCTCCACCTTCAGCAATAGC TGGAGGAATGTGACCTCTTCTCACTGCCCCCAGCCCATCCTCATCCCAGC ACCCTCACTGGATCATTACTGTGCCCACCCCCATCTTCCCGCTCCCACCT GTCCTCCTGCCTTGTCTGTTCCTAAAACTGCAGGCACCTGTGACCCTTCT GAAGCATAAGCCAGCTCCTGTCCTTCCTCTGGACTCGGTGTGGCTCAAGC CCTGACTGCTGGAGGCACACATGGGGACATCGAAAATGCTCTCGGGCCTG GGCTCCATCTGTGGAGACTTGGATTCACTTGGTTTTAAAAGTTCCACAGG TGACTGCAAAGCCATGGTTGAATCCTCAGGAAGATCTACCAGCCCTTCCC CACCCTCTGCCAGCTCTCTGGCCTCGTTTCCACGGCCCTCTCCCACCCTC ACTGTGCACCCTCTCTTTGGCCTCTCTGCTCACCAGGAATGCTCCCACTT TGTGCTTGGGATTCTCTTCCTAAGTCCTGCCTGACTGGCTTTGCCTCCTT CAGATCTTCACTCAAATATCACCTAAGCGAGGCCTCTGACCAGTTTATTT AAAATCAGATCCCCTGGACTACCGCAAGCCCACCCTCCTTCTCCTCTTTC CTGTTTTATTTTCCTGCATTGTCTTCATCGCTGGCTGACATCCCTTGTAT TTTGAATGTTACTATGGAGTTCCACAAGGGCAGGAATTTTAGCAGGTTTT TTTTTTTTTTTTTCTGAGTTGTGTTCCTGGTGCCAAGAATGGTAGAAATA AATATTTGCAAATAAATACTCAATGAATGAAACACATGCAGGAAGGAGCT GTAAAGCTGCCCACGGAGGTGAGGAAAGGCCAGGACAGGCAAACAGTGCT GACAATGATTGGCTTCCCTGAGGCACGTTTTCTACTTTGTCCCCCAGTTT GCAACATTCTTTTTCACCCCCAGAAGAGCACAAAAAAGGCTTGGCCAAAT TACATCTAAGTTCCATTCCACGTATTTTCCTTTTATTTAAGGTGTTTACA GAACGATGTCTTGCTGGGCACAGGAGAAGCAGGAAGCAAGCCTGTCTCCT CTCAGCACCTGCTAACCGGGTGAGTGATGCCAATTAGTGGTGTGTCAAGG GCCTGAAAAGAATCAGACTGGGCTTAAAAGGGATCAGGCAGTAAGCCTGA CACAGATTTAATAAGCTGTCTCCTACCTTCGGAGCAGGTTTTTTTTTTTT TTTAATTTTTGAACCTACTTCTGTCAAGAGGCATCCCGACTACTTTAGTG GATACCCAGCAGAGATGCTGTTTACTCAGTGACTCCCGAGTGCAGTCAAA GATGACCTCTGGGGGGGTCATGTGGTCCAACAGGCCAATTAACTCTTCTC CTTGTCAATACGTGGAAACTTCCCGCAACTTCCATGGCAACGTATTTTCT GAATTAATTCCTGGTATGAGGAAAAAGCGGAGAAGGCAATGGCACCCCAC TCCAGTACTCTTGCCTGGAAAATCGCATGGATGGAGGAGCCTGGTAGGCT GCAGTCCATGGGGTCGCTAAGAGTAGGACACGACTGAGCGACTTCACTTT CACTTTTCACTTTCACACATTGGAGAAGGAAATGGCAACCCACTCCAGTG TTTTTGCCTGGAGAATCCCAGGGATGGTGGAGCCTGGTGGGCTGCCGTCT ATGGGGTCACACAGAGTCAGACACGACTGAAGCGACTTAGCAGCAGCAGC AGCATCAGCGGCAGCATGAGGAAAAAGTTACATTACCACAGAGAACACCA GGCAAAAGGAGAAACCTGAAAGTGGTGGGGTGGGTACCACAAGGCTTGGT CACTCAGAAAACCCGCCTACTCCAGGTGATGGCCAACTGTGTGGTGGTGG ATGGGAGGTGCTTGGTGAACTGTGAAACGCAAGATGACCTTGATGATCGA AGACGGTGACTGGGCCGGTGGCTGCCCAGGATAGGTCGCCCTGGCGCAGT GGCCCCCTCCTCCATCAGGGTTTTCCAGAATCTCTCCTCCTTCCTTCTCT ACCTGGACTCTTCCTTCTGCTCCATTGAGAGTTTGTGTAATATCAAAACC AAGAGAGCAGAGGCCAGTGCACTGCTTTTGGGAGATGATTACTTCTCTTG CCATTTTATACTCTATATTGGTAAGCACTTTTTTTCAGGTCTGCGCCATG TCATCAACTTAATTTCTGACTATTAATACTAACATTGAGGAATAAGAAAT CATGATGAAAAATGAATAGCTAACATTTGGTGAGCACTCGCCAAAGCACA GCCTCTTTTTAAAGTGTTTTCCAGGTAATCCTCCTAACGACTTCTGAGTT AGGGATTACTTTGAAAGCCCCTGGCCTGCACTCAGGCTGAAGCACAGAAA TTCAGAAACTTGCTCAAGGTCATCCAGCCGGTCAAGGGTAGAACCAGTGC TCATCCACATTTCATTTAATCTAGGCAACGCCACACTGAAGTAAGCACTG TGAAGCCATCTTACCTAGGACTGAAAATGGAAAGAAATGAATTACTCACC CAAGGCCATATGGCTATTAACTAAGAAGTTAAGATACGAACCTGTTTGGC TTCAAAGCCCTTGGCTGTACTTTAGTTGGTTTCTTGGGTAAAGCCAACTC TTTTTGATTCATTATTAATATTCTGAATTTGGTATTACCATAAGTTTTGC AGCAAGCAGGCATCCAGAAATCCCTAGATATTAGGTTAAGAGTCTATCAT ACTTAGCTTCATTTTAAAAACAGCCAGTCATCGAAGTCTGAGTAGCAGCA CCTTTGAGTTGAAAAGAATGATGACGCTAGGCACCCGAGACTGGTCTGTG CGCTGGGCACAGTGCCAGGTTCTTGCTGATAGAGTGCAAAGAAGTGCACC ATCTCTGTGAGGCAGGCATCAAAAGACCCACTTTCAGATGGGAAAATTTG CCTGAGGCTACGTAACAGAGCTTGCACCTAGCTGAGAGGGGATATGATTT TATATCCCTCGACCAAAGCACACGGTCCTCTCTCCACCTGTGGTTCGTGC AAAAGCCATGTGCTGAAGGGTACCCCAGGTATCTTAAAGAAAGAAAGAAA GAAAGTGAAGTCACTCAGTCGTGTCCGACTCTTTGCGACCCCATGGGCTG TAGCCTACCAGGCTCCTCTGTCCATGGGATTTTCCAGGCAATAGTCCTGG AGTGGATTGCCATTTCCTTCTCCAGGGGATCTTCCCAACCCAGGGATCGA ACCTGGGTCTCCCACATTGTAGACAGATGCTTTACCATCTGAGCCACCAG GGACATCAGGTATCTTAGCCACATCGTTATTTTTTCTTTATAACAAAAGA ACTAAGAATGCTTGTCATTGCATTGGGGAGCTTTTTGAGTGTGAACCCTT TCTGGGCTTGTCTGAATCCTTCTGAACAGGCAGCAGGTTGTTCACTGGTC CCAGATAGCCATCTCAGGAAAAATGCTACTATTGGCCACCAGGAAGCCTC TTGAAAATTGAAGATATTCATCATAAACCTAGCTTTTCTGTTGGGAAACA ATTCTGAGAGCATATCCTACACAAACTAGGTCTAGGAGCACCTGGATTCC TATGCCAAAAAGCAGATATGGAATCCATTTGGCCCATAGGCCCTTCTTTA TGCTCATGGATAGATTAAGTTTATTTATTCATTGTTTTAAATATTCATAT TAAATTCTTTCCAGAAAGTGTTTATTGACAGCTGGATAAAAATCAACTGA ATGTGTCCAATAAAAGTATTTCTGAAAATATAAACAGCATCTTTTTCTTC CCATGTGTCTCCCTCCCTCCCTTCCTTTTTCTCACTCTTTCTTTTTAAAT TAAATCACTACATGTTTAATAATTACTTTGGTTCTAGTCTACAAAAGCTT TAGTACTACTCTCCTAGACTAATATATTCTTTAGAATCTCATTTTTGGAC TCTGCTAATATATGCCATTTATAGTCTGAAAACACATTGTGTTTTATCAT TCAGCTCCATTTCTAATGTTAAATTCAACTCATTACTATCACTAGTCTTT CTTTTTATAATTTATTTTATCAAACTATAGTTGATATACAATGTTGTATT AGTTTCTGCTGTACTGCAAAGTGATTCAATTACACATACATGTGTATATA TATTTTTTCATATTCTTTTCCCTTGTGGTTTATTACAGGATATTTAATAT AATTTCTTCTGTTATACAGCAGGGCCTTGTTTATCCATTCTATATATAAT AGTTTGCTTCTGTGTCCATCCTAAAGGAGATCAGTCCTGGGTGTTCATTG GAAGGACTGATGGTGAAGCTGAGACTCCAATACTTTGGCCACCTCATGCG AAGAGCTGACTCATGAGANCTACGACCATCATCCCCCC project fbnv AJ 20040903 6088bp AGGCCAGTTGTGTCGTGGCGTGTCTTTGTTGCCTGGGGTGCCGCTCTTTT GTATTTTGGTGCTATTCTGTTCGTTTCGCTGGGTCCTCTCGCACGGTTGC TATTCTGCGCCTGCGTCCTCCTCCCCCTCTATCGTCTCGGTCGGTGGGCG GTTGCTCGTAGCGGGGGGTCTTCTCGTTTCGATGTGGTTGGTTGCGTGTC TTTATCTGGTTGTCGCTGTTGCTCTCGTGGCTTCTCGTCTTTTCCTCCGT GGGCGTGTGCTTGTTTGCTTCGTTGGGTTGGTTTTTTGTTTCGTTGTGCT GGTTTGTGTGGAGCGTTGTGTTGCGACGTTGCGGTCGGTTTTGCGTTCGT CGGTGGCTGGCCTGCGCGTTCGTTTCATTCGCGCGTTCGGCGCCGGCCCG GTGGGCGTCGGCTGGCGCGTCTTGCGGGGCTTGGTGTTCGGGCTCGCCGG CCGTGTGTCTTCGCTTCTCGCTCCTTTCCCCCCTTCTCTCCTTCTGCCCA GGGCCTTTGGACTGTGCGTGTTCTTGTCGTGTTGTCAGGTTGGGCGGGTT TCGCGTTCTCTCGCTGTCCGTTTTCGTCGCCTATCTTGGTCTTTCTTGTT TGTCTTTGGTGTCTCTTCTCCTTAATTCTTATATGAGTTTTTTTATTTTC TTGGGACTTGCTGGGAGCAGGAGCTTCGTTTGGGAAAATCCTCCACGCAT AGTTCACTTGTTTTTCAAAAAAAAAAACTTGCAGATTCACAGATTTAAAT AGGAAAATAAAATCCATCCTGGAATAAGAAATTTTGAAAATAATGCATGC AAGTTTTTGAAAACATTATCAAAGCTGCTTTGGGAACTAAAGGTGATAAG AATATTAATGAAATACAGTTTGAAAATTACCAGAGATCCTGGGAGGAAGA AGGTGGCTAGATTCTTTGAAATCATACTGAGCCTAAATGACTGGAAAAAT ATGATAGTAATTGTATCACAGTGACACCCAGACACTCCTCATACCTAAGG ACATCAGCTAAGAGCAGAGCTTTGCTCTGTGTATCACAGGCTCTTATTGG AACAGTCTTCTAAATGATTGAAAATATTTTTATCTTCTTCAGAGAAGAAA ACTAATGTCAGATTTTCATCTAGAGGGATGTATACACACACACACACACA TACACACACTCCTACTCATAAATCTTCTGTGGATGAATTTGGTAGACAGA TCATCCTTTCAGGTCTTTCTCTTTAAAAATCAATCCAAGGGTATTTTTAA AGCCATTTCTCATGAAAAATCTCTGTGATGGTGTTTAAAATGGTTGTTTA AAAATATGCCTAACATGCAGTAGATGCTTGTTATTTCTTGGCTATTTGAT GGATCTAAAATGGCTTGAAGAGGGGAGAGAAAGAAGACACGAAGACCAGG TATTGACTATTGCAACAGCCCAGCAAAAAGTGATGAGGATTTATTTGGTG GCAATGGGAAGAAGAGAGAAGACACCAGGGCCATTGTACAGGTAAAGCTA ACTTCCTTATTGGATATGTGGCAGCTTCTTACAATCTAGAGAAACTAGAG GGCTTTCTACTAATTTCCTTTATCAACTTTCCTAGCTTTACTCATTCTCT ATGAAAAGTTTTGTTCTCACCAAATCATCTGGAAAGTAAACAAAGCTAAA ACATGTAAATAATTAAAATTAGCTATATTCCAGTAACATCAAAGGCAATC ACTATACTCTTTGTGATATATTTTATAGATAAAACATGCCTTTAATGTAG TCATGTCTGGAGAGGTTGAAATCATAGTTAAAAGAGACATTTATCTTCAG GAAGTAAGAAGATAAGAGGAAAAAAGGAAAAGACTATCACTTATATGAAA TCTAAAAGTGTGTGTATTTGCCTTTTGTTGAGACTGGTCCTTGGATGAGC CAAACCAGATCTCTCAGAAAGACAAGCTTCTCCTATAAATGGTGTGTCAC TTCCTTGAATTTGGGGATGAATGTGGAGCAGAGTCTTTGGTTCCCCTGTA GACTCACTCCTATATACAGAATTCATGGTGTCTGCTAGGATTTATCCTCA AAAATTGCATTGGGTTCATCTGTTGATGCCTGTGAACTACTTCTGGTTGG GAAGGTAGAGGATAAAAGGGAAAGAAATAGCCCACAATCCTAGTTCAGAC TAAGGAATTGAGAGAGAGTTTAAGAAATTGGAATAATTGATAGTTCGATT CAGTGATTGTGTTTCAAGGGCCTGCTTTGTGTTTACTAATAGGCTTTACA AAAATTCTTGCATCAAATTGTTACGGATTTTAAAAACTTCCACTTTCTGC ATTTGACTTGTTTTCAGTATTCCTTCTTTTGATGCATTGTAAGTTGATAA GATATGAGGCCTCCATACTATTGAGCAGTTAGCACAAAAAACTTTCATCC TTGTTCCCTGTTCTCGCTTATGTGTGTCTTATTAGCAACTGGTTAGAGAT AGGATTTGGAGAAGGCAATGGCACCCCACTCCAGTACTCTTGCCTGGAAA ATCCCATGGATGGAGGAGCCTGGTGGGCTGCAGTCCATGGGGTCACTGGG AGTCAGACACGATTGAGCAACTTCACTTTCACTTTTCACTTTCATGCATT GGAGAAGGAAATGGCAAGCCACTCCAGTGTTCTTGCCTGGAGAATCCCAG GGACAGGAGAGCCTCGTGGGCTGCCGTCTATGGGGTCTCACAGAGTCAGA CATGACTGAAGCAACTTAGCAGCAGCAGCAGCAGCAGCAGCAGAGATAGG ATTTGGTATCAGGCAGAAATATCTGGGAAGAACTGTTCACATATATTTAG AGTAAAAGGTTCTATAATGTGATGAAAGAAAATAAAGCACAGTTAAGCAG AGCCCAGCCTAGCACCTCCGCCTGGAGAGCAGCCTCTGGGACCCCCAGGA AGCAAATTAAAGCACATGTAACCTGAAGCAATGGCACCCTACTCCAGTAC TCTTGCCTGGAAAATCCCACGGACGGAGGAGCCTGGTGGGTTGCAGTCCA TGGGGTCGCTAAGAGTCAGACACGACTGAGCGACTTCACTTTCACTTTTC ACTTTCATACATTGGAGAAGGAAATGGCAAGCCACTCCAGTGTTCTTGCC TGGAGAATCCCAGGGACAGGGGAGCCTGGTGGGCTGCCGTCTATGGGGTC GCATAGAGTTGGACACAACTGAAGTGACTTAGCAGCAAGCCTACATATGG GTATTTTAAAATTATGGCTTATGTGCAGCAGCTTAAAAAGTATATTAGTG TTACTTCCACCCATGTGACCTAATATTTATGTCGTTCACTTAAATGGTGA AGATGACCTTGTCAATGTCCTGCTTCTTTTTTGAGGATTCCAACTTTTTC TTTTCCTATATGTCCATCTAAATGAACCATGGCTGTGGGGGCTGGTGGAG AGCAGTAGATGGGGAGATGAACTCTCCACCAAGGAAGTAAAACACTTAGA TATGCTTCTATGAAGTACCTGGGGTAGGTCATGTAGGGTCAAAAAATGCA AATAATTCCTCTTAAGGGCACTAAGGATAAGTTAAGAGTGACTCTCTGGT GCTTTTGAGGTCCTTGTGAATCCTAAATTCTGGAAATAGAAAGGGCTTCA ACAAGTTCTGCCATATGCCTTGTCCTGGCAGGTTTTGCCCTTATTATTCC CCATGATAGCAAAGAGCACCTTTGCCACTGCCGTGTGCAGGTCAGGGCTG TGCAATCCACAAATCAAACAGGCAGCAGTTGGCTTTTAGGATGTGACTCC AAGTCCACAGCACAGGCTCCTGTGGGGATTATGCTCAGCCAGACCTGCCA GGGCACACTGAGAAGGATCTGTCCTGGGACATTTTATTGTTCTTAACTCC CAGGCATTTCTCTGTAAATTTTTCAAGGGTTGTTTTCGATAAGAAATTCT GAATTCAGGGTATTTTTTGTGAATTTATCATTTCTGCATTCCTCAAGGTT GAAATGATTAAGGCTCCTATGTAGCAACTTTGTTCTGGGAAGTGACTAAA TTGTGCCTGAAGTGATTAAACTAGGGCCTAATTCCCCATCTGCATTTGTG GTGGCTGCCATTCATCTGCCATGAGGCTACAGCTAAAAGCAGCCATAGAG CTTTCTCAATCCAACATTTTGGGAATTCTATTGGTATTAGTATGTGAAAG GCAGCCTATTTGCCTAGATTAGGGAGCTTCAGTTCAGAGTTGCACAGAGG ACTTATTAATAAGAACGCTATATTTAGGACAGGATTCCTTAGTTGACCCC TGGCTTGCCTTGGTGGGAAACCAAATCTCAAAATAATCCAAAAACTCACC CAGGCTCTCAGGAAGTGTCAGGATAAGCAAGGCCAGCTGACTTGGTCTCA TCCCAGGTTACATTCATCATCAACCTGGATTTACTTCCAGAGAAGAAAAA TGCCAACCTTACCTTTATTCAAGTTTCACTGTCTCATTTTAGACTGTTCT AGAATAGAGTCCATAATTTTTGTTTTAGTGGGAGAAAAAAGATTCTTTAG GGCAAGTAATACTCTTAACTAATTAGGTGAAAATTGTCTTTTCTCTGAAA GTAATCAGATTCACGTGAGCAGGAGTGGTAGATGGAGAAGTTTTGTATGT AAAGCTTTTCTGCTTAAGTAACAATGTTAATTTAGCTAATACTTACTGAG TGCCAAGCACCGTATTAGTTGAAAGTCAACAGAGAAGAACAATACAAGGA TCCTGATCTTCAGAGGATGGAGGGTGAACCCCAAGCAATGGCCATACCGG TGTGTAACTCTCGTGCGATACGGACTATATGTGCAATAAGGCGAATACGA ACCAGACGCTAGCTAGAGAGCACAAAGAAGGACGTGCCAGCCATCCTGGA GTTCAAGGAGTTCTCAAGGACATGGAAAGAATGTCAAATTACTCAACCCG CGCATAACAAGACTGGTGGCTTTTAGAGTTTGCCACTTGGTTCTATAAAA GTTCTCAGCCTAAGAACTCAGAGGAGAGTTTCAAGAAGGAGCTTCCCCAC TGTCACCTTGTGATCCGGGTTTAAGGTTGCATTGAATTGTTTTGACAACC TCAGGATCAGGTTTGATTTTTTGGCTTTGGCTTTTAATATGTGGTGTTTT CACCTTCAAGTATCTTTTTTTTAAGTCGTGTCATGACTGGTTTTTTTGAG GGGGCAATGTTTTTGTTAATAACTGACGTATTGCGCAGAAACTGTGGAGG AGGATTCAGATAGGTGTCTAGGCTGGCCTTTACTCCTGCTTACAGCTTTA TTTGTCGTTGATTGTTTATTATTGTTTTTTCTGTTGTTTTTTTTTTTGCT TGTTTTTATCCGCGAGCGCGTACTATGTCACTACTAATATCTATGCAGAT GTCCTATTAGTAGGAGGGAGGGGAGTGTTTGATCATTTATGAAAATTAGT ATCATCTTCGCCTTCCATTCTCTGTGTGTCTGCTCGGTGTTCCATCTACA CCGCTCCTTAATTGCTCCATCTATTTAACATCTAATTTATGACTTAAAAG CATGCAGCCATCTTTATTAGATTTAACCCCGATAAGTTTAACTTTAACTT TGTTCTTTTTTTTTGACTTTCTACCCACATCTTTTTGTTAGCTGTGTCAT GCGTCCAATTTTTGATTAATAATAGCCTATATATGTATTCATGTTTTCTT GTTTCAAGTCCTCTTTTTTAATATCCTATTAATTAAGACTTGCACTCCCG ACCTCTTATTTTATTATCACTTTATTCATACTCTTCTAGAATCCAGCGAA TATCTTGTCTTTCGCGCGTCTGACCCCCCACTTTCAAGCGTAACCTTCGT ACTATCCAGTGAATTTTTTTTCAGCTTCTTCTTATTAATGTGCAACTCTT GTCTATCCCGTCGGTCTTATATCGATTGCCACAGTCTTTTACCTTTACCC TTTTTCCTCTATCTACCCTCGACTCAATTGTCTTATAAAAGACTATTTTT TCTACTTTTGCTCTCGGTTTAAGCCTTTAATTTTATACCCCTACAGCCTA TTTTTTTTTGTTCTACAATAAGTATTATCCACAACCGTCTCCCTTTCCAA TCATGTTCACCCACTTTCCAAGCCATATATACCAATCT project fbnv AK 20040903 5713bp TGGGAAAATTTTTAATAATGATACCATGTATAACTCTTCTGAAGTTATTA CCATTATGATATCCTTAGCATAAAACATGTGATCAATAAAATAGTCTCTG TCCCCTACCTCTATAGTGAAAAAAAAAGCATTCCAGTTAGGAAAATCACT TTTGCGGATAAATTACGGTAAGACTATTTGCTGTGTAAAAAAAATCTTAA TGACTTAGCACAGCACAAGCTTATTTCTCACTCACATAAAATTCAAAAGA AATGTTCTTGGTTAGGTGGCAGGAATGGAAAAATGGGCATAGAAATGGAG GAAGACTCTGCTCCATACAACCATTCAGAGCTCCAAGCTGATGGAATCTC CACCACCTTCTACACGGCTTCCAACATCATCCTGTTTGTTAATATCTACT TGGCAGAAAGGGAGGGAAAAGTACCAAGAAGGTTCTTAATCATCTTGGTC AAGAAATGGCCAACATCATCTCCACTCATATTGTGCTAGCAAGAACTAGC AACATGGCCCAGCCTGGATGCAAGGGATGGAGGGGCTGGGAAATGTGGGC CTGGGCTGGTTGGGCCTTCTCAGCATGAGCTCTGCTCCCGGACAGGGATT TTGCCATCTTTGCCACAGCAAAGTGCGGGGGAAGAGAAGAGATTAAGCAA AAGCCTACAGAGTGAACCAGTCTGCCTGGCAAGCCTAGGCATTGAGGTCC CAAGGCAGATACAACTAGAGGTTATCATACTAAGTGAAGTAAGTCAGAAA GAGACAAATGCCATATGACATCACGTACGTGTGGAATCTAAAATATGACA CCAAGGAACCTATCTATGAAACAGGTTGTCAAGGGGAAGGGAACTGGGGA AAGGATGGAGTAGGAGGCTGGGGTTAGCAGACGTAAGCTTTTGTATATAG GATGTACACACGACGAGGTCCTACCGTATAGACGGGGAACCATATTCGAC ACCCTGTGATAAACCATAACAGAGAAGAATATTTTTAAAAGAATGCACAT ATATATAGCTGCTAAGTCACTTCAGTCCTGTCCAACTCTGTGCAACCCCA TAGACGGCAGCCCACCAGGCTCCTCTGTCCCTGGGATTCTCCAGGCAAGA ACACTGGAGTGGGTTGCCATTTCCTTCTCCAATGCATGAAAGTTAAAGTG AAGTCGCTCAGTCGTGTCCGACTCTGTGCGACCCCATGGACTGCAGCCCA CCAGGCTCCTCCATCCATGGGATTTTCCAGGCAAGAGTACTGGAGTGGGG TGCCATTGTCTTCTCCGATATATATATATAGAGAGAGATACACATATATT GCAGGCAGATTTTTTTACTGTCTGAGCTGCCAGAGAAGCACGGGGAGACA AAATAACATTTTTGAAAACTGCAGTTACAGTAGTAGATTATATGGTTATA CATTATATTATTGGATGAAAGAAAACATTAAAAAGTTGAAAGTTGACTGT AAATATGAATTTCTATACAACAAACTTCCTCTTCCCACTGACTTCTATTA TAAATGAAAGATGCATTTCTCTGGATAATGAAAGTTGATGTGGGAGATAC CATGTAGGAAAGTAGTAAGTCTTTTATATTGACATATTTAAAGGAAAATT CTATTTTAACATCTCAATAAAGGTATTGAGATGTCAAAATGTGAACGCTG TACAGTTAAGATTAATTTCATGTTTGACACAACATCATGGAAGTCTAGGG AAAAATGACATTTTAACGGCACCAAATATATGGGCTAAAAATCACGCAGG CATAATTCTTTTGAGGTTCTCTGAAGTTGTCCTAACAGTCACTGGATGCT GATGGGTTTTAGAAATTAATAGTCTGGGCCAAGATAAAGAAGGAGAACAA AACATTGCAGAGGCAGCAATTAAAGCAGAGCAGCAAGCGAAGAAACACAG TGGCCGAGCCTGCAGGTTTATAAAAGTAACCATGGGGAAGCACACTGACT GAAAGGGAGCGTTGGAAGGGATGTGAGAATTCCATGAAAAGGGTCCTTAG TGATCCAACTGATTCATTTTTTTTAATTATGGAGAAGTGCCTGAATGAAA ACCAGGTTCATTTTATAATGAAAGGAACATTTTTCTGAAGCTACACTTTT GCCTTTAAACAGCACTGTTTATCAAGTAACTGTTCCTCAAGGTCTGATTT ACAACTATCTCAAATCAAAATAAAATTCATAATAATAGGATCACAGGTGC CCCACTGGCTGTCTGTCCTTGCCTAACTATTGTTTTTTTTTTTCCCCTGG TGGCTCAGACGGTAAAGAATCCGCCTGCAATGCGGAAGACCTCTGTTTGA TGCCTGGATGGGGAAGATCCCCTGGAGAAGGACATGGCAACCCACTGCAG TATTCTTGCCTGGAGAATCCCCGTGGACAAAGGAGCCTGGCGGGCTACAG TCCATGGGTCCGAATCACACGACTGAGCAACGAAGGCTTTCACGTTCACA TGCCGGGGTATCACCGCTGCTCGTGCGCCATCTAGTGGTCCATGCTGTGA TATTTTCTGTTTTTTTGCTGAGGTAGAAAACACTTTAAAAGACGTTTCAG ATCAGATCAGATCAGTCGCTCAGTCGTGTCCGACTCTTTGCGACCCCATG AATCGCAGCATGCCAGGCCTCCCTGTCCATCACCAACTCCCGGAGTTCAC TCAGACTCACATCCATCGAGTCAGTGGTGCCATCCAGCCATCTCATCCTC TGTCGTCTCCTTCCCCTCCTGCCCCCAATCCCTCCCAGCATCAGGGGCTT TTCCAATGAGTCAACTCTTCGCATGAGGTGGCCAAAGGACTGGAGTTTCA GCTTTAGCATCATTCCTTCCAAAGAAATCCCAGGGCTGATTTCCTTCAGA ATGGACTGGTTGGATCTCCTTGCAGTCCAAGAGACTCTCAAGAGTCTTCT CCAACACCACAGTTCAAAAGCATCAATTCTTCGGCGCTCAGCCTTCTTCA CAGTCCAACTCTCACATCCATACATGACCACTGGAAAAACCATAGCCTTG ACTAGATGGACCTTTGTTGGCAAAGTAATATCTCTGCTTTTGAATATGCT ATCTAGGTTGGTCATAACCTTCCTTCCAAGGAGTAAGCGTCTTTTAATTT CATGACTACAGTCACCATCTGCAGTGATTTTGGAGCCCCCCAAAAATAAA GTCTGACACTGTTTCCACTGTTTCCCCATCTATTTGCCATGCAGTGGTGG GACCGGATGCCATGATCTTCGTTTTCTGAATGTTGAGCTTTAAGCCAACT TTTTCACTCTCCACTTTCACTTTCATCAAGAGGCTTTTGAGTTCCTCTTC ACTTTCTGCCATAAGGGTGGGGTCATCTGCATATCTGAGGTTATTGATAT TTCTCCCGGCAATCTTGATTCCAGCTTGTGTTTCTTCCAGTCCAGCGTTT CTCATGATGTACTCTGCATAGAAGTGAAATAAGCAGGGTGACAATATACA GCCTTGACGAACTCCTTTTCCTATTTGGAACCAGTCTGTTGTTCCATGTC CAGTTCTAACTGTTGCTTCCTGACCTGCATACAAATTTCTCAAGAGGCAG ATCACATGGTCTGGTATTTCCATCTCTTTCAGAATTTTCCACAGTTTATT GTGATCCACACAGTCAAAGGCTTTGGCATAGTCAATAAAGCAGAAATAGA TGTTTTTCTGGAACTCTCTTGCTTTTTCTATGACCCAGCGGATGTTGGCA ATTTGATCTCTGGTTCCTCTGCCTTTTCTAAAACCAGCTTGAACATCAGG AAGTTCACGGTTCACATATTGCTGAAGCCTGGCTTGGAGAATTTTGAGCA TTACTTTACTAGCGTGTGAGATGAGTGCAATTGTGTGGTAGTTTGAACAT TCTTTGGCATGCCTTTCTTAGGGATGGGATGAAAACTGCCCTTTTCCAGT CCTGTGGCCACTGCTGAGTTTTCCACCTTTGCTGACGTATTGAGCGCAGC ACTTTCACAGCATCCTCTTTCAGTATTTGAAATAGCTTAACTGGAATTTC ATCACCTGCACCAGCTTTGTTAGTACTGATGCTTCCCAAGGCCCACTTGA CTTCACATTCCAGGATGTCTGGCTCTAGGTGAGTGATCACACCATTGTGA TTATCTGGGTCATGAAGATCTTTTTTGTACAGTATTCTTGCCACCTCTTC TTAATATCTTCTGCTTCTGTTAGGTCCATACCATTTCTGTCCTTTATTGA TAGAGTCAACTGACAAATTAACAGGAGATTTATTGTAAGTTTTATGTGAC TCAGGAGCTTCACAGGTAAACAAAGATCTGAGACCGGAGTATTTGTATAA ACAAATACTGTATAAAAAAACAGGCCAGAGTATTTTTCTGCTGGGTCTGG ATGAAGAGTGTACAGGTGTGGAGAGCTCTGGTAAGTCAAAGCATAGGAGG TAGGTATAGTAAACTGAGGGAACTTAGCAAGCCCTGTGTGCCAGGATTCT TCTTGGCATCCCTTTGTCTTTGGTTATAAGGATGATCTTTTCCTCCAGGT TCAAGGCAGTCACCTCTCATGTAAGGATTTTATGACCTGTTTTAGAGGGG AATGCCAGAGAGGATGACCTTCCTGCTTCTGATGTTTTCTCAACTTCTAC AACTTAAAATATTTAGTTTTCCAAGTTGCCATATTTTGGAGTAGCATATC TTGAACCCCATCAAAAGGGGTTCAGGGGCTTTGAGATGCCTGCAAGTTCA TAAATTCTAATAGACATTTCAAGTTGGAGGACTCCAGGAACTTAAAGAAC AGATGTAGTTGGAATAATGAAGAAGAAGTAGGAAAGAGTAGGACTAAGGA AAGGCTGGAAGGTTAAGAATTTTGTCTAAGCATGACATATTAGAACTTAA GATTCAACATTGGCGTAGTTACTGACCATAAGACTAAGGGTGTTACAGAC TACAGGGAGGCGGAAAAAAAAAACCCAAACAAAAACCATTGAAGTTGGGG TCAGGAAATGTTGTGGCTAGGGTTCAGTGGGTCACCACACCAATACTGAA ATCCCTCAGGATAATGAGAAGGATTGTGGTGAAGATAAAGCCTATGAGCT AGAAGTCAAGAACTTTAGTAGTACACCTACTATCTAATCAAGAGACAGTA GATTACAGTGGTCAGGTTTACCTCCATTAGTGCTGGACAGATTTTGGTTC AAATCACAGGTAAATCACTGACCACTTCTCATCCTTGGGCACCTTGCTCA CCATGTCAAATCATACTCTATTCAACTATAAAATGGGGGAAATAATAATG TCTATCTTATAGAGCCTTTCTGTGTAGCAGATACCAATAACTGCCTCCGA ACAGCCATTCACATCTTCACTAACATAACACAGTCTTCTATGAATACTGT GATCAGGTTGGCCCTAAACTTAGACCCACTGGGTAGACCTTGATTCATTT TAACCAGAGCGATTTCTTCATCTCTTCCAATAATTGACTTAGGAAGGATC CAATACCAGACAATGAGATGTAGGATAATTCGGCTAGGATGACTTCTGGG AAACATTATCTTTCTCTTCACAGGTGTTTGTGAAGATATGATGTTAGAAG TTCCTGCAACCATCTTGCTACTGTGAAGAAAATTAGCAGATAAACTGAGA GCGTCCGTGCAGAAAGACAGAGAGAACTCCTAATTATTTGGCAAAAGCAG TATTTGGAAAACTAACTGCAGAAATTCCAAAAATCAGTTGTGAACTTGAG AATTTAGATTGAA project fbnv AL 20040903 4913bp AAGCAAGTTCTCTTTAAAAGCAAACGACGCAAGAAGGGCACGGAACGCCC GTGAGAGAGGAGGGAGAGAGGGAGCCCCAGGGGAGGGCAAGGAGGAGAGG GGCCCGACAAAAAGCCGCGGCATCCACGGGGACCAAAGAAAGGCGCGGGG GAAGGACACCCCTCCCAGAACAACAGCTGAGGAAAAACCCACGAGCGCAA GCCAGCCCAGGCAGAAAGGACCAGGAGCCACTAAAACCCAGAGCGACGAT ATCTGGCCAACAGGGCTTGACAGAGGCGGGGGGGGGGGGGGACTCCCACC CCCACCACACTCTCCGGCTTGTGCTCTGATTAACTGGATAGCACTTGCAC CATAGAACCCCACACGTTATTAATAGCAGAGTTTACCATTTGCTTGGTCC ATATGCTGTGATTTAGACAGAATGGAACATGACTATTGATCTAAGGTGGT TTCAAAGATTTGGTCCAAAGGGAAAAATTCTATTGCCTCCTGGATTATGG CCTTGCAAGGTGATGGGATGAGCCTCTGTCCTGATGCCTTGGGTATCTTC GATATGCAGACCCCAGAACATCTCTCAGTTGATTCTCCAGTGCTGCCCCA GGATACTCTCACTCTATGTCAATTACCTTCACACCTGGCAGATCCAGTTT TGACATTAGCACTGCAACATTGTCCTTCTTTTGTTGGGGGGCTTGGGTGG GACCTCCTTCCAAGGTACACTGGCTGTGTATGTGGAATCTTTTCCTGGTC ATAAAACATATTGGGAGTGTCAGCATTGGGAGAGTTCTTATTTCTCATGC AACATCTTTCTTGCAAGTTGGAACTACTGTCTTTGGATGGTGAAAGAGAC AAGAGACAACTCCATTGCGTGTGAAAGTTGCTCAGCTGTGTCCAACCCTT TGCGACCCCATGGATTATACAGTCCATGGAATTTTCTAGGCCAGAATACT GGAGTGGGTAGCCTTTCCCTTCTCCAGGGGATCGTCCCAACCCAGGGATC AAACCCAGGTCTCCCACATTGCAGGCAGATTCTTTACCAGCTGAGCCATA AAGGAAGCCCAAGAATACTGGAGTGGATAGCCTATCCCTTCTCCAGGGAT CTTCCTGACCCAGGAATCGAACTGGGGTCTCCTGCATTGCAGACAGATTC TTTACCAACTGAGCCATCAGAGAAGCCCTTGGTTGGTGAAGAAGTCTGTA AATGGTCTCTATATCTTGTAGTTAAGGAGTTTTTCCAAGATAATTTAGAA TTAAAACAGACAATCACAGTTTGATTTTCGGCGTGATCAGTTCAGTTCAG TCGCTCAGTTGTGTCTGACTCTTTGCGACCCCATGAATCTCAGCACGCCA GTCCTCCCTGTCCATCACCAACTCCTGGAGTTCACCTAGACTCACATCCA TCGAGTGATGGTGATCTTCAAAGAAAAGAGTATGTCTTTTCTATCTGCTC TAAAATTTATGACAGTCTGTGCTTATACCTCATAGTTTAGTTCAGTTCAG TTGCTCAGTCATGTCCGACTCTTTGTAACGCCCTGGAGTGCAGCATGCTA GGCTTCCCTGTCCATCACCAACTCCCGGAGTTTACTCAAACTAATGTCCA TTGAGTCGGTGATGCCATCCAACTGTCTCATCCTCTGTTATTCCCTTCTC CTCCTGCCTTCAATCTTTACCCAAATGGGGGTCTTTTCCAATGAGTCAGT TCTTCTCATTAGGTGGCCAAAGTATTGAAGTTTCAGCTTCAGCATCAGTC CTTCCAATGAATATTCAGGACTGATTTCCTTTAGGATGGACGGCTGGATC TCCTTGAAGTCCAAGGGACTCTCAAGAATCTCCTCCAATGCCACAGTTCA AAAGCATCAATTCTTTGGTGCTCAGCTTTCTTTATAGTCCAACTCTCACA TCCGTCCATGACCACTGGAAAACCAAAGCCTTGACTAGATGGACCTTTGT TGGCAAAGTAATGTCTCTGCTTTTTAATATGCTGTCTAGGTTGGTCAAAA CTTTTCTTCCAAGGAGTAAGCGTCTTTTAATTTCATGGCTGCAGTCACCA TCTGCAGTGATTCTGGAGCCCCCAAAAATAAAGTCTGTTACTGTTTCCAT TGTTTCCCCATCTATTTGTCATGAAGTGATGGGACCAGATGCCATGATCT TAGTTTTCTGAATGTTGACCTTTAAGCCAACTTTTTCACACTCCTCTTTC ACTCTCGTCAAGAGACTCTTTAGTTCTTCTTCACTTTCTGCCATAAGCGT GGTATCATCTGCATGTCTGAGGTTATTGATATTTCTCCTGGCAATCTTGA TTCCAGCTGTGCTTCATCCAGCCCAGTATTTCTCATAGCGTACTCTGCAA ATAAGTTAAATAGGCAGGGTGACAATATATAGCCTTGATGTATTCCTTTC CTGATTTGGAACCAGTCTGTTGTTCCATGTCCAATTCTAACTGTTGCTTC TTGACCTCATAATGCTATAATTTTTTTCAGTACTATAATTAAAAATGAAT TTCAAATAGTTTATCTAAGTTAATACTTTCCAGGTAGCTCAGTGGTCAAA AACCTGCCTGCCAATGTAGGAGACACAAATTTGATCCCTGGGGAAGATTT CCTGGGAAAGGAAATGGCAACCCACTCCAGTATTCTTGCCTGGGAAATCC CATGGATGAGAAGCCTGGTAGGCTACAGTCCATGGGGTTGGAAAAAGTCA GACACCACTTAGCAACTAAACAGCAACAACAACAACAGCAATCTAACTAA TTACATGCACATGGTTTAAAAACAATAGTCAGTATTTAGACATTTTGATT AAAAATTACAGATTGGTTAACCCATCTCTCCTTATCATTCCCCCCAGAAC ACACACACGCACAAATAATTTTCAATTTCTTTAACTGTTGTCTGGATTTT ACCATCACATTTTAAAACTGCAATATCTCCATCTTGATTCATTTCAACTT TAGCTAATATTTATTGTTGAGATTATTTACCTCTTACAAGTCCTGCTCCC TTAACACTTCCCTTTGCCCCTTCTTCTGTTTCTTCCAGCGATATCACAAT TTCTCAAATTAAGTATTTAGTTCACAATTGCATTACTATAGCTATATAAA CACCACTGAGTCAAACTTTATAGTTTGATGTATTTTCTTTTTTGTATAAT AATACTTAATTTTCCTTCTCTATTTTTTTGTAGTTTCTTGTGTATCTATT AAACTGCTCCATGAGACCTGTAAAATAGTATTAAATTATCCAAATACCTA CCTCAGATATTTATTGATGTCACATCTGTCCCCTGAAACTCACACGCAAA CCTCCATTCCTGACTCTTCATTTCTTCTGTTCCAGATTTCCTAAATTACT TTCTAGTCTTGAGTGAAGCTTCCATCTGGATTCTTCCCTTTGCTGTTTTC CTATGCTGGGTCCCTAATTTCCTGGGCCATATACAACTTCCTTCTGTAGG TGTATATCATCATTTTCTAAAGCATATTCTCCAGTACATTTGTAAGAAAG GGTGCAGGGGTGATTATTTTCCTCAGCCCTGGTACATCTGAAAATATCTT TTGCTATACTTCCTTTGTAGTTAGGCTGAGTATAGAACTTTGGGCCTAAA GTTTTTTTCTCAGATTTTGAAGATATTGATTAGTTAGCTTTTAATGCTGC AAATGAAAAGTGTGATGCCACACCACTGATTTTATATATATCTCCACACA TATACACATCAGTTCAGTTCAGTCACTCAGTCGTGTCTGACTCTGCGACC CCCTGGATTGCAGCACGCCAGGCTTTCCTGTCCATCACCAACTCCTAGAG CTTACTCAAACTTAAGTCCATAGAGTCAGACACATATGTATGTTCTGGCT ATTTAAGTATTAAGAATCTTATATTTATGTTTTTAGTCTTCTTTAATTTA AAAATGTCTTGAAATAAATTAAAAAAAATTGTTACTCAGAGTGTTCTGTG GAGTTTTGATTTTGGAAGCCCATGTCCTTTAGCCATAGAAAATTTTCTTG CTATTGCTATTTTACTTTCCTCTACTCCATATTCTTTGCTCTCTTTTCCT AGAAATCTTATTATTGAAATTCTTGTTGATCTTCCAATTTTATCTTATCT CTACTGGATTACAACTCTTTGTCTTTTTGTTTCATTTTTTTGGGATTGTT CCTTTGATTTAGTTGTAATTGCATTTTTATTTGTGGGAATCTTTATTTAT TCACAGGAACTTGGTGTGTTATGAAAATATTGAGAATGTTGTAGGCTTTA TACAGATGTTTGATAGTCTGTGGCTTGCCATGCACATTTTTCTAATGGCT TTACTGATATATACTGCACATACCATAGCATTCACCCATTTCAAGGGCAC ATGTCAATGTTTGTAGTGTAACCACAGAGTTGTGCAGCCATCACCACAGT AAGGCTTAGCAATTTCCATTATCCCTAAAAGAAACCTTGTACCATCAGTA GTCACTCTCCATTTACCCTCAGTCAATTTCTCCCCTCCCTGCTCCTGACC CAGCTCTAAGAACTCACTACTTTACTTTCTATGTATTTGTCTATTGGGGG CATTTCATAAAAGTTGAATCATAAAATAGTCTTTTGTGACTGTCTTCTTT TATTTATGAAGTTTTCAAGATTCATTCAGTGTTGCTGCATGTATTAGAAC TTCATTTCTTTTGCTGATGAATAATATTCCATTGTAAGAATATATCATAC TTTGTTTATCCATGTCAGTTTATGGGCATTTGAGTGGTTTCCACTTTTTG ATTACTATGAAGAAGCCTGCTATGAACATTCCTGTGTAAGTAAGTATGTG GGCATGCCTTCATTTCTCTTGAGTTTATATTTAGGGGTAGCATTGCTGGA TCATATGATATTTCTCATACTGTTCATGGGGTTTGATGAACTANCTGCAG TCATTTACCCGCC project fbnv AM 20040903 3878bp CTCCTCGGGAGGTAATGTAGAGTCCGGTTATGTGGAGCGTGTGGAATCAT TTCAGTTATTCTTTGTGGTAAAAGTCAGAAGCGGAAGGGACAAGTTGGTT TCAGTCCGAGGGTCTTATTATATTCTAACGAGATTGTGGGGTTTCACATT TCACTTTACTTTTCAAACAATGGAAGAGGAAAGACCAAGCCAGTTCAGGT TTTTCCATGGGGAATACCAAGGGACAGGGGAAGCTGGGGGGTGTGCCTTT TTTTGGGGTTCGCATAGAATTTGGACACAACTGGAAATGACATGACCAGC TAGCTTCTCGATGTGTGTATTTTAATAATTTTGGTTTAATGTGCTGCAGC GTTTAAAGAGGTATATTAAGTGTTGCTTGCCTGCCCATGTGGCCATAAAA TTATTGTCGGTCACCTTAAATGGGGAAAGATGGCCCTGTTCAATGTCTTG CTTCTTTTGTGAGGATTTCGAACTATTTCTTTTCCTATATGTCCTTCTAA ATGAACCATGCCTGTGGGGGTTGTTGGAGAGCAGTAGATGGGGAGATGAA CTCTCCTCCAAGGAAGTAAAACACCTAGATATGCTTCTATGAAGTACTTG GGGTAGGTCACGTAGGGTCAAAAAATGCAAGTGATTCCTCTTAAGGGCAC TAAGGATAAGTTAAGAGTGGCTCTCTGGTGCTTTTGAGGTCCTTGTGAAT CCTAAATTCTGGAAATAGAAAGGGCTTCAACAAGTTCTGCCATATGCCTT GTCCTGGCAGGTTTTGCCCTAATTATTCCCCATGATGCAGAAGAGCGCCT TTGCCACTGCGGTGTGTTGGTCACCCCCAACAATCCGCAAATCAAACAGA CAAAAAAAGAGTTCTTTGATGAGAATATAAGGTCCGCAGCTCTGGCTCAG GAGGGAGATTAAAGTTGAAACTCCAGTACTTTGGCCCCCTCAGGCGAGGA GTTGATTCATTGGAAAATACTCTGATTCTGGGAGGGATTGGGGGCAGGAG GAGAAGGGGACGACAGAGGATGATATGGCTGGATGGCATCACTGACTCGA TGGACGTGAGTCTGGGTGAACTCCGGGAGTTGGTGATGGACAGGGAGGCC TGGTGTGCTGTGATTCATGGGGTTGCAAAGATTCGGACACGACTTTTTAA GGGACCTGAACTGAACTGAGATGCTTTTCTGGAACTCTCTTGCTTTTTCC ATGATCCAGCAGATGTTGTCAATTTGATCTCTGGTTCCTCTGCCTTTTCT AAATCCAGCTTGAACGTACAACTCAACATCAAAAAACCAAACAACCCAAT TGAAAAATTTGCAGAGACCCTGAATACATATTTTTCCAAAGAAGGCATAC AGATGGCCAACAGACATAAGAAAAAATACCTAACATCACTAATCATCAGG AAAACGCAAATCAAAACCACAATGCAATATCCCCTCACACCTGTCAGAAT GGCTATCATCAAAAGAATAAGGAATAACAAGCGTTGATGAGGATATAGAG AAAAGGGAACCCTTGTGTACTATTGGTAAGAATGTAAATTGGCACAACCA CTCTGGAAAACAGTATGGAGGTTCCTCAAAAAATTAAAAATAGAGCTGCT ACATGATCCAACAATTCTACCTCTGGATATTTTTTTTGAAGAAAGCAAAA AATGCAAATTCGAAATGGTATATGCATGCCTGTGTTCACTGCAGCATTAT TTACAAGAGCTAAGATAATAAAAGGAACCAAGTGTCCATCAATAGAGGGA CAGATGAAGATGTGGTGTGTTATACATATACACACACACAATCAATATTG TTTAGGAATAAAAAAGAATGAACTTTCACCATTTGTGACCACACTAATGG ACCTAGAGGACATTATGCTAAGTGAAATAAATCAGACAGAGAAAGACAAA TACTGTAAGATCTCACTTAAATGTTGAATCTGAAAAACAAAATAAACCAG GAACTTCCCTGGTGGTCCGGTGGTTAGGACTCTGCGCTTCCAATGCAGGA GATGCAGATTTGATCTCTGGTGGGGGAACTAGGATCCTACATGCTATGTG GCAAAAAGAATAAAAAAACAAACATAAATACAGAGAGCAAACTGGTGGTT TCTAGAGAGCAGAGGGGTGAGAAGTTGGGTAAAATAGATAAAGGAGATTA CCAAATACAAACTTTCAGTTATAAAATAAATGTCATAGGGATATAATATA CAGCATAAAAAATATAGTCAACAATATTATAATAATTTTCTCTGGTGACA AATAGTTACTAAACTTGTCATGGTGAGCATTTTCTAATGTATTTTATTGA TCACTGTTTTATACTGAAAATGAATATAATATCATACATCAATTATACAT TAATAAATAATAATATTTAAAAATAAAACACTGACACAAAAACTTTTAAA AGGATCCTTTTAATAACAGGATAATATGTTTTAATGAATGTGCCATAATT TATTTGCTACAATTACATTTCAGATAATGCCATTAATATAAATAACACTA TGATAAGCATCACTATACACATATTTTTTCTGTTTCTCATTATTTTCTTA TATGAAAATCCTATAAATTACTTATTGTTCTTATTGAATGGTACTTAATT TTGTGATTTGACTCAAATGTCTATTAATATACTAACATTGTATAAAGATT CAATAAGATAATGTATGTTCTTATTTTCCAAATCTGTATAGGAATAAAAG CTGTGGTTATACAACTAGAAGCACTAGAAAAATATTAAGAAGAGGTGGCA AGAATACACAGAAGAGCTATACAAAAAAAGGTCTTAATGTCACAGATAAC CACAATGGTGTGGCCACTCATCTAGAGCCAGACACCCTGGAATATGAAGT CAAGTGAGCCTTAGGAAGCATATTGTGAACAAAGCCAGTGGCGGTTATAG AATTCCAGCTGAGCTATTTCTAATCCTAAAAAATGATGCTGTGAAAGTGC TGCACTCAAGATGCCAGCAAATTCGGAAACCTCAGAAGGGGCCACAGGAC TGGAAAAGGTCAGTTTCGTTTTCATTCCAATCCCAAAGAAGGCAATGCCA AAGAATGTTCAAACTACCCTACAAGTGTATTCATTTTACATGCTAGCATG GTAATGCTCAAAATCCTTTAATTTAGGCTTCAACAGTACATGAATCTAGA ACTTCTAGATATACAAGCTGAATTAGAAGGTGGAGAAACCAGAGATCAAA TTACCAACATTCATTGGATCATAGAGAAAGCAAGGGAATTCCAGGAGAAC ATCTATTTCTGCTTTATTGACTACTCTAAATCCTTCAACTGTGTGGATCA CAACAAACTGTGGAAAATTCTTAAAGAGATATGAATACCGGATCACCTTA CCTGTCTCCTGAGAAACGTGTATGGAGGTCAAGACGCAACAATTAGAACC AGATATGGGACAACTGATTGTTTCAAATTGGGAAAGGAGGGACGACAAAC GTTTTACGCCACTCGGCTTGATCAGGCATTCTTGCAGGACGAGTCGATGG GGAAGGCTGGCCTGGTTGACTGCACACTTTTGAGTGGGGAGGGGCACCAC TGCCCAGATTATATTATGTTGGCATTCCCCTCAAACCACCAAACACCTAC CCACACTTTTAATCCTCCTAAGACGGTCGCGCGGCCATCTTCGCCAACAC TCTGTCCTATGTGGACCAGTCATCCCGCCTGTCCGTCCGCGCGACCCCTG GGCGGGACGTGTTAATGGCAGTGCCCCGATCCCGATCCCCCTGTCTGGCC CCCTCCGCCGCTGCTCGGGTGAAGGCTGGGCCGCAGTTCCGTCTTGCCGT CGTGCCACAGTGGATTTAATTCAGTTTTGCTCATAGCTGCTACTCCTGGT TATTTTTCTATCTTTCTCTCCCACGATT project fbnv AN 20040903 3566bp TGCTGGGGCAGTTTTGCACCTAACTCTGTACATGGCTTCATACTGAGGGC ATGGATTATTTTCAAATTATCAAAAGGATTCCTAGTAATTCAGTTTGTAA GGAGGAAAGTCTGAAATGCAAGGCAGATACTCAACTTGGGCATGGATTAT TTTCAAATTATCAAAAGGATTCCTAGTAATTCAGTTTGTAAGGAGGAAAG TCTGAAATGCAAGGCAGATACTCAACTTCGTGTGTGCATGCTCAGTTGCT AAGTCAGTGTCTGACTCTTTGCAACCCCATGGACTGTAGCCCACCAGGCT TCTCTCTCTATGGGATTTCCCGGGCAAGAATGCTAGAGTGGGTCACCATT TCCTCCTCCAGGGGATCTTCCCAACCCAGGGATCAAACCTGTGTCTCTTG CATTGGCAAGTGGATTCTTTACCACTGAGCCACCTAGGAAGCCCTAGGAA CTCAGGGATGATATTAATTGGGGCATAGCCTTCTATGAAGTAGAAATTAT GTAGCTGAAATTTCTTTTAAGGGGAGTCATGACAGCTTTCAGAGTAGATG GTTACAGACTTTAGAACTCTCACAAGAATGTTAAGGACAAGGTTGCTGTG CCTCACTGACTTGTCTGAGTCTCTATTAGCAGAGCTAGAATTTGAATCCA AGGACCTAAAATTCCCAGTGCCAAGTGCAGAACTCTGTATAACAAAGCTT CCCCCCTTCAGAATAAAATTCTCTTTCTTCCTGGCCGTCTTCCAGGGCCT TCAGCATTCACAAGAGAGAAGAGTGGAGACGTTTCTCTCAGTGTGAACTT AGCAAAATAGATGAAAGAGCTTCCCCAGGTCCCCATGCACTTTAATGGGA CTTTGTGCCTCCCTTGGTTCCTTCTGTTAGTGATCAGACGAATGCTTCAG ATTTGCGTCAAGCGTGGCGAAAGCGCTGGGATTTTGCCCACTGGCAAGCT AACTCGTTCACCTGCTGAAGTTTAATGGATGCTGGTAGAAAACCCAAACC TCCTGGGTCAGAGACAAAGGACAGTTCATTATTCATATAGCAAAACTGTA GTTGCCAGACTCTGAGCATTTTTTGCACCAGCTCCCTAAGCTCCAACTTC CAAAAGGTAATAGAAAAAGACCAGATGATACCCGTGAATCCAGCAGATTG TGTCCCAGGAGAACTCTGACCTGAATCTTCTAGAATGGGCAGTAAACATA ACAATTCTTTGCTCCGGAGAGAGACCTTGTATTCATCATACTGGGAAGCA GATTTGCCTGTCCTTTGCTCCCATGAGAAACTCTGTTGGGAGTTTCAAGG TTGTTCTCTGCACAAGTATCTTTGAATAGATAGTCTGCCACAAAAGCCAA TCATCGCCTCTATTTGCAAGATATGCAGAGTGGTTGAGAGGCCCTGGAGC TGGCCTGAGATCCATGGAGGATGGTTTCCTACTCACACGAATATATGAAA ACCAATCCTATTCAAGTTACTGAATGTTCTGCTATTTTCAAAATGTCTAA GTTAGCTGAATTACTCGACAATCAGACGTGAGTTTCATGTTATTTCAATA AAGTCTTACAACAAGGAAGCTGATTTTTGACCCACCTGTACTCAGTACTA ATGGGAGAATCCTGGTAATTTTTAAAATTATTTTTCTAAGTATTTCATTC TTCCAATGAAAGAAAAAAAAGTATTCTCTTTAACACATAAGGGCATGTGA AATATTTTCTTGTTTAGGTAGGGTCATGGAGCAGGAAGGATCAGTGATAA CCCAATTTCTTGGTACCCAAATCAGCAACACATATTTTCGTGTTCAGTAC AGCATTTGATAGGTACTGTCATGCTGATATGTGTAAATAACTCCCATGTA CAGTAATCATTTATGTTAATATAGTTCATCTTTATGATAAGAGAAAAGAT ACCATCATAAGTATTAAAAGATTAAAATCCTATGTAAATAGTTTTAATTG ATGATTAGAATTTTGGCCATTTATGCAACAATTTCTTTTCTGTTTCTTTT GTTGTTCAGTTACTAAGTTGTGTCTGACTTTTTGTGACCCCATGGACATC AGTATGCCAGGCTCCTCCTCTCTCTTCCACTATCTCCTGGAGTTCAAATT

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnv.fa (2013-03-31)
    Open archived version from archive


  • TCAGTTATGTCTGACTATTTGTGCCCCCATGAATCGCAGCACGCCAGGCC TCCCGGTCCAACACAAACTCCGGGAGTTCACCCAGACTCACGTCCATTGA GTCAGTGATGCCATCCAGCCATCTCATCCTCTGTCGTCCCCTTCTCCTCC TGCCCTCAATCCCTCCCAGCATCAGAGTCTTTTCGCGAATGAGTCAACTC TTCGCATGAGGTGGCCAAAGTACTGGAGTTTCAGCTTTCGCATCATTCCT TCCAAAGAAATCCCAGGGCTGATCTCCTTCAGGATGGACTGGTTGGATCT CCTTGCAGTCCAAGGGACTCTCAAGAGTCTTCTCCAACACCACACTTCAA AAGCATCAATTCTTCGGCTCTCAGCCTTCTTCACAGTCCAACTCTCACAT CCATACATGACCACAGGAAAAACCATAGCCTTGACTAGACGAACCTTTGT TGGCAAAGTAATGTCTCTGCTTTTGAATATGCTATCTAGGTTGGTCATAA CTTTCCTTCCAAGGAGTAAGTGTCTTTTAATTTCATGGCTGCAGTCACCA TCTGCAGTGATTTTGGAGCCCCCAAAAATAAAGTCTGACACTGTTTCCCC ATCTATTTCCCATGAAGTGATGGGACCGGATGCCATGATCTTCGTTTTCT GAATGTTGAGCTTTAAGTCAACTTTTTCACTCTCCACTTTCACTTTCATC AAGAGGCTTTTTAGTTCCTCTTCACTTTCTGCCATAAGGGTGGTGTCATC TGCATATCTGAGGTTATTGATATTTCTCCCAGCAATCTTGATTCCAGCTT GTGTTTCTTCCAGTCCAGCATTTCTCATGATGTACTCTGCATATAAGTTA AACAGGGTGACAATATACAGCCTTGACGAACTCCTTTTCCTATGTGGAAC CAGTTTGTTCTTCCATGTCGTTCTAACTGTTGCTTCCTGACGTGCAGACA GGTTTCTCAAGAGGCAGATCAGGTGGTCTGGTATTGCCATCTCTTTCAGA ATTTTCCACAGTTTATTGTGATCCACACAGTCAAAGGCTTTGGCATAGTC AATAAAGCAGAAATAGATGTTTTTTCTGGAACTCTCTTGCTTTTTCCATG ATCCAGCAGATGTTGGCAATTTGATCTCTGGTTCCTCTGCCTTTTCTAAA ACCAGCTTAAACATCAGGAAGTTCACGGTTCACATATTGCTAAAGCCTGG CTTGGAGAATTTTGAGCATCACTTTACTAGCGTGTGAGATGAGTGCAATT GTGCGGTAGTTTGAGCATTCTTTGGCATTGCCTTTCTTTGGGATTGGAAT GAAAACGGACCTTTTCCAGTCCTGTGGCCACTGCTGAGTTTTCCAAATTT GCTGGCATATTGAGTGCAGCACTTTCACAGCATGATCTTTCAGGATTTGA AATAGCTCACCTGGAATTCCATCACCTCCACTATCTTTGTTCGTAGTGAT GCTTTCTAAGGCCCACTGGACTTCACATTCCAGGATGTCTGGCTCTAGGT GAGTGATCACATCATTGTGATTATCTGGGTCATGAAGATCTTTTTTGTAC AGTTCTTCTGTGTATTCTTGCCATCTCTTCTTAATATCTTCTGCTTCTGT TAGGTCCATACCATTTCTGTCCTTTATCGAGCCCATCTTTGCATGAAATG TTCCTTTGGTATCTCTGATTTTCTTGAAGAGATCTCTAGTCTTTCCCATT CTATTGTTTTCCTCTATTTCTTTGCATTGATCGCTGAAGAAGGCTTTCTT ATCTCTTCTTGCTATTCTTTGGAACTCTGCATTCAGATGTTTATATCTTT CCTTTTCTCCTTTGCTTTTCGCTTCTTTTCTTTTCACAGCTATTTGTAAG GCCTCCCCAGACAGCCATTTTGCTTTTTTGCATTTTTTTTCCATGGGAAT GGTCTTGATCCCTGTCTCCTGTACAATGTCACAAACCTCCTTCCATAGTT CATCAGGCACTCTATCTATTAGATTTAGGCCCTTAAATCTGTTTCTTACT TCCACTGTCTAATCATAAGGGATTTGATTTAGGTCATACCTGAATGGTCT AGTGGTTTTCCCTACTTTCTTCAATTTAAGTCTGAATTTGGCAATAAGGA GTTCATGGTCTGAGCCACAGTCAGCTCCTGGTCTTGATTTTGCTGACTGT ATAGAACTTCTCCATCTTTGGCTGCAAAGAATATAATCAGTCTGATTTCG GTGTTGACCATCTGGTGATGTCCATGTGTAGAGTCTTCTCTTGTGTTGTT GGAAGAGGGTTTTTGCTACGACCAGTGCATTTTCTTGGCAAAACTCTATT AGTCTTTGCCCTGCTTCATTCTGTATTTCAAGGCCAAATTTTCCTGTTAC TCCAGGTGTTTCTTGACTTCCTACTTTTGCATTCCAGTCCCCTATAATGA AAAGGACATCTTTTTTGGGTGTTAGTTCTAAAAGGTCTTGTAGGTCTTCA CAGAACCATTCAACTTCAGCTTCTTCAGCGTTACTGGTTGGGGCATAGAC TTGGATTACTGTGATATTGAATGGTTTGCCTTTGAAACAAACAAAGATCA TTCTGTCATTTTTGAGATTGCATCCAAGTACTGCATTTCGGACTTTTTTG TTGACCATGATGGCTACTCCATTTCTTCTGAGGAATTCCTTCCCGCAGTA GTAGATATAATGGTCATCTGAGTTAAATTCACCCATTCCAGTCCATTTCA GTTTGCTGATTCCTAGAATGTCAATCATTCTATTCTGTATAATGTGGCAG TATATAATATTAAAATATATGGCATACATAATTATGTATTATATATGTAT GTTATATGTAATATTTTAATATTATATATTGCCACATATATAGAATAGAT TGATATATATATAATGTAATATAACACTGTATAATTTAATGATATAATTA GGTAAATATATAAGACAGAAGAGTCATATATGTAATACAGAAAGATTATA TAATAATACAGGAAGAATATATATCATATATTTATAAATATATGATGTAA AGTTCCTTCTTCATTTCCTCTTCATAAATGGTATAGGTTATACCCTTCAA ATATACAAGACTATATAGATGAGAAGCAATACTATATGAGAAGCAAATAA TCCTGGTCCAATTAGCCATTATATTTATACATTGATCCATGCATCTACTT CTTAAACCAATAATTAGTAAATATTGTCTGTCTCCCAGTATCATGTTATG TACTACGAAAAAGAAATTAATAGGTTGGGTGCCCTGACATGACTTAATCT TATAAATTTTTTAACTTAAATTTCTTGAACTTTTGTACTGTTTATAGAAA AACATAGGATGATAAGAATTGAGAGTTTACAATATTTTACATGTTTGCAC TGCTATCTGAAATAACTCCAGTGATAATTCTAGTATATTTGTGAATAATG ACTATTGTGTCTTTCTATATTATAATGAACTGATAATCTAGGCTGATAAT GTACATTTTAAATCAGCTGCATTGCTAATAAATGGTATTAAGTACTTAAC AAAGTATTCTTAAAATGAGTGATGAATAGATAAATATAATGAGATTCTTG GTTTTTGAAGAGAGATGGATAAATAAACAACTGATTGCTTTTAGTGCACA CAATGAGGAGAAAAGTGTAAAGCATAATCTCATTTTATGGACCTGTTCAT CCCTAAGTATCACTTGAGAGGAAAGCTTACTGGAATTGTTGATTAATGAG AGGGGAAAGTAATCAAGACACACTTAGAGCATAGAAACATGTAGGGAGTG AGATTTAGGCAAAGGAACTTGCATGAGTCCATAAATCAATATGAAAATAG TTAGGTAGAGTGTGATGGAACACCTATAGTATACAAAATTAAGACAGGGT ATAGAATCTACTGTTTTTACTTACTTGTATTATTCAGTAAATGTGTGTGT ATTACTCAGTAAATACCTATTTCGTGTCTGTTAGGCGTCAGGCAATGCAG GGGAGAAAAAAGTTTGCAAAATAGCTTTGTCCATTGATATATATAAAGAT GTATTCTTGCATGTTGCGAATATTTATTGTGCACTTACTATTCAGTGGCA GGCCTTGCAGGGAAAATTTCAATGAGAAAACTAGACAAAACTACCTGCCT CATATGATCTCCATCCTCGCGATGGAATATTAGAGGGAGATGTTCTTTTA GAATAAAAGATTGGGACAAAGACAAAAAGAAGAGAATGGGCCAGAGAAAC AGAAGGAAGAGTATACTTGAATTATCGTAAATCTGAGTTTGAGTTCCATT AGGGTCCTATTAGATGCCATTAAATAGTACTGAGAAATGCTTAAGGACCA ATACAATTTCCTAGAGATAATATGGGGTCATGAAAAATCTGAAACCTATC CTGGAAGGAAGGTTGAGTTAGCCTTTTGCAAAGAGATAGATTATTGTGAG ATGAGTAAGACCTATAAACTCATTTGCACTGTTCAAGTGTAATACGAATA CTCAAAGTAGTTTAATGGTTGAGGTCTGTAAAAACAGCCCAATCTTCTTA GTCCATCACCTATCAAAACCAGCATGGTCAGGAGATGAGGATCTTAACTT CGACTTGGATCTGTAGCTTTTTATACCCTTCCCTATCCCAGGTGGAGAAA AAGGGAGAACTATAGCATAAAACAGTCCCAGTAAATGCCAGGTGGATTTA CCGTGGATATAACCTTATTTTTATTTTAGTGAGTCAATTTAAATTGAAGC CAAGTATGGATTTTTGTTTTGTGTTCTTCACACTACACACACTAACTCCA CAGAAACAAAGGGCCTGCTGTCTTCCAGGAAATATTAGATGTTGGTTTTG ACTAACATCTGCTTTTTTCTTTGTTTGTTTGTTTTGAATTTTGCATCAGA ATTGAGGTTCATTGAAAAACCATAAAGAAAGTTAATGTAGAATGTCCCAA CATTCAAATCTCTAGATATTTAAATGTCACTTTACAGACTTTTTATTAAC CATAGTATTTCTGAATTATCGCTGTAATATTTCAGTAATGGGATAGAAGC TGTCAAGGTCAGAACAGCCTCATAAGGGAGACATGCAAAAAGAAAGCATT AGATCTGAAAAGCACAATGGTAGCTGTTCTAAGGAACCTTTTTATTAAAG TAATGGACCAAAAGATATTATGTAGAACTGTGAGATTCCAGAAAACACCA TGTGGCAAGTTTGCTCAGAGATGAAAAGCAGTTTTTCCTTTCTGTTATCT TTATAATTTAGCACATAAAACACCTTGGCTCCTTTCATTCCAAGTAAAAT GTATATTTAATATCCATAAAGCTTAATGAAACTGGCTTTTCTACAGAAAG TCTGATTTAAATGACTTTAAATTGCATTTTTAGTCTACAGACCAGTGATG TTATTTGCAATGCTCCTGGTAGCCTGCAGGCGGAGCCCTGGGCTGCACAA AAGGTGGGTGCAGCCTCTATCAGTGAGCCGCAGACCTTTCCTCTCTTGGT CTGAAAGGTCCTGACAGCTGCATATAACAACTAGGAACTAGCTTGGTCAT TACTCTCACTAGGATACTGAATGTTTTTTTTTTTTTTTTCATATTTAGTA GTTCAGTCAATGGTCAAATTTCAGATCATGGGATAAATCATCTACCTTTC TTTCTCATCACTCCACTCTGTTATCAAAAACAGACAGAAGAGAAAGCAAA ACTCTTAGCAATGGGTATTGATTTAAAACCCCACAGACCATCAGTATGTG CATAGCATTCACAGTTTACTGAAAGTCTCTCTTCTCATTTGCTCCTCTTG CTACCCCTGTGAAGCACAGTTTATTAGTATTCTGATTTGGTACCTGACAA TTCTGAAGTGTAAAGACGTCACATAGCTGATGATGTTAATTAAGTCAATA GGTGTTAGATACAGGACCCAAATCAAGACACCCTTATATTTTATATTTTA CAATATGTGTAGGTTTTTTCTCTGCATTTACACATCCTATGAAATTATTT TACACCTTTTTTTATAGTAGCATCATCCCAAAGAGATCCAAATGAGTTCA AACCTTCAGGAGCTGTGTAATCCTAAAGAAGATTGAAAAAGTCTACCACG CGTTCTTTTTTTTCTTTGTCAGAATAACTTGAGTCTAAGTTTAGATATGA TTTTTCACTAAAATTTAATATCATCTCTGGAAAAGTGTTCTATATAGATG TTTGTATTTTAGTTCTGTGTAGATAATAGTTATATTAATATCATCAAAGG AATCAACTTTCAAATCATATTTTTTTTCTTCTTTGAACTAGACCTGAAAT AAAGCCTCTTGAACTGACACTTTCTTTAAAAACCTTTAATGAAATCTTTT TGAAATCCCCAAATAAGGTCTGATTAATATTATTTATTGTAAATCCCTTG TCATGGTTTGCTAAGTCAATACACATACCTTGATGCATCAAAATGCTTTT TCAATGAAATCACTAGACCACAAAATAATTGTTATGTTTTCCTCCATCAT TTAACCAGTAATGATTTTTCAATGTTTTTCTATGTAATTAAATGTGTCTG TGAATCATTAATGCCATCTAAAAGTACAACATCCATAAAATTGTTGATTT GACAGTAATATAAACATGAGGCGTGAATGTTCCCAAGTTTTTTGAGAGGC AAAACCTTTTTTGTGAAACGTTAATATTTTGCCACTAAGGGACATTTAAC TCTAACCAAATGCATAGCTACTTACTCTAGTTTAAATTGCATTCAGAGAC TTATATTTTGGGATAGTATTTCAAATACTCTTGACTGTAAGATTATTCTA GATAATCAACAGTTTCTAAGAGCAAGCTCATCTTTAATTTAGAATAATCA TGAAATAATTCCAAGAGGAATTTCAAATAATAATCATTATTATTTTGAAC AATAATTAAATATATCAAATAAGATTAGCACAAAGTCAAACAAAAGACTG GCCCTAGCACAGAGAGAGATCAATATTCCCTCTCTCTCAAAAATACCTTT TTAACATTTTTTAATTACTTTGTGTTTCCTTTGTTTTTGTTGAATTTTAG GAAAGTCAATATTCTAAAGATGGGGGAGAGAGACACCAATATAGTTTCAC TAACAAACGTCTTATTACTTTCCCCCACATAATTTCCAGTTATAATGAGC AGAATAGAGAACTACTGCATCATTCCCC project fbnw AH 20040830 9043bp GTTTCCCTTTCCCGGGTTTTTAAAACCAGGTTGGAAGGAACATGGGATCA CGGGTTTTCTTCCCTTCGGTTTCTCCAGGGGTATGCCCACCAGTGGGATG CTGGTTTTTTTTTATATGCAACAGAAAAATAAAGTTTTTAAATCAAAAAT CAGAAGGAAATATGTTTTCCTTCTTTTAAGGCTTCAAGGGAGTGGGTGAA AAATTGCATGTGTAAAGCTCTCAGCAGTTTCCTAGAAACTCCTCAGATTC TTGAGCCTCAGTGCTCCAGGAGTCTGAACTCATGAACAGTGATTTCCTGC AACACCTGTTCTTCTCAGCTGCATTAGAGCTGCACCTGTCTCCGGCCCGT GTTCTGCTAGCTCTTCAGATGAAAGCATCTAATTCCCTTTGTCCCCTCTG AGATACAGAGAGTCATTTCTGCTTTTACCCTCATCAAAGCCTTGAATGAT TCAGAACTTTCTAAAATAAATGGCTCAGTTGTGGGAAACTAGAATTAGTT AACTGACTCAGTCTTATTTGAAAAGTATAATGAAATAATTGATAAAATAA ATTAAATACAAGTAGGCTGCAGCATGCCTGGAGTTGCCTGAAAAGAAATG TTTCTTCAAAATATGGCTTTGGGAGACCACAATGATCATTGCAATAGAAT TTAACTAAGGAAATAAGGCATATAAGTACTATGAGAAGGCTAATTCTGAC TGTGTGGTTAGCTCATCAAAAAACTTACAAATTCAGAACTTTAAACGTTT GGCTTAAGGCAAGACCAAGACAAAAACAAGATTCTATTACCGGTTTTTTA AAATCTCTAATCCCCTAGAACCTCAGGATCAATGTTAAAAATAAGATCTA AGTAAACCATTCAAGGCCCTAAATTATTAGTTGATATTCAGAGTCATTCA CAAGATCTGTAGGACTCTTATATGAAAGAAGACAAAATGTGACACAATAA TTTAGAATGGTGATATTTAGTAGATTCTGGGGATTATGAATAGGCTGAAC CTCAAAATTGTATTGTATCTCCCCTGCCAACAAAACCATTTCTTTCTCAT CTGTCTGAAATTATTCTCCTTATACTGGAAGACCCTATCATGAGGTAATT TGCTTATTTCCAAGGGTTGTTAATTCCCTTCAAGACCTCTCTCTGCTTTG CTTAGTTGCTCGGTTGTTTCCAACTCTTTGTGACCCCATGGACTGTAGCC CACCTGTGTCCTCTGTCCAGGGAATTCTCCAGACAAGAATTTGAATGGGT TGCCATTTCCTTTTCTGGGCTTCAAGACCTATCCTCACCAAATTTCAGTG CCCACCTACTCAGAGCAAAAGTTAAACCCCAATTCATTCTAAAGAATTAG TTTCCTTCCAGCTTAACCTATAAGGAGGGAATGTATAAACCACAATAATT GTAATTGCTTTGTCAATATATATCAAAAGAAAATGAAAGAATATGCGTAG GAATGGGCTTTGAGGGTGGCTAGGAGGTTAAAGGAGAAGGCAATGGCACC CCACTCCAGTACTCTTGCCTGGAAAATCCCATGGACGGAGGAGCCTGGTG GGCTGCAGTCCATGGGGTCGCTAAGAGTCGGACACGACTGAGCGACTTCA CTTTCACGTTTCACTTTCATGCATTGGGGAAGGAAATGGCAACCCACTCC AGTGTTCTTGCCTGGAGAATCCCAGGGATGGGGGAGCCTGGTGAACTGCC GTCTATAGGGTCGCATAGAGTCGGACACAACTGAAGTGGCTTAGCAGCAG CAGTAGCAGCAGCAGAGGTTAAAGCGTCTGCCTGCAATGCAGGGGACCTG GGTTTGATCCCTGGGTCGGGAAGATGCCCTGGAGAAGGATATGGCAACCC ACTCCAGTATTCTTTCCTGGAGAATCCCATGAACGGAGGAGCCTGGTGGG CTACAGTCCATGGGGTCGCAAAGAGTCAGACACAACTGAGCGACTTCACT CACTCACACTCACCAGAGAAGAAACCAAATTAAATGCAAGGATGTTGATA AACAGAGCATGTCTCTGGTCCACCATATCAAAGTGGGAAGGAAAAGTAGC AAATACCTTAATTGACTTGATAAAAAATATGCTTGGCCTCACAAAAATTC AGAATTCAGAGGCATGCCACTTTGATAAAGTTTTTAGACTTCAAAGGCTT GCCAAAGCATCTTTCCAAAATCAAATAAAAATTACTCTACTTTACTCCCC ATATCACTAAAAAGAGAAAAGATTTTTTGGTTGTCTTGAGAGGTGAGCAT GTTGTTCCTAGCCATTTATCAAGTGGCCCAAAGCCACAGGATCTGAATGA GGATCAGAGTAAGCGAATGCTCTGCAGGCAGTGGAGACTTGAGAACAAGA GGCTCAGCCAATTGGACCTTGTGAAACAGAAGATGCAAAGATGCTCAATA TGCTATCACCAACAGGATGCAATATGCAGTCACTAGTCATCTGAAGCAAA GCAATGGACCCTTCCACAAAAACTACTTTCACTTTGAGCTCCAACTCCTG AATTGCTATTATATTTGTACATAGTAACTAATTTTACATTTTATTCTTCC TTTCTTCCCACATTGTCTTATAAAACATATGTTATAGTATTTTTATTTCT CTTTTTTCTAAATTATAGAATGTAAAGGTAATCTGTAACTGAACAGGAAG TGCAGCAATCATTACACAGAGATGGATACAATAAATTATGGGATTTTGTG TCTCTCGTCTCCCTACCCGCTAACCCAGGGTGAGGTCTGAAAAGTGAAAG TGAAGGCTCAGTCATGTCTGACTCTTTGCTACCCCATGGATTATACAGTC CATGGAATTCTCCAGGCCAGAATACTGGATCCTTTCCCTTCTCCAGGGAT CTTCCAAGCACCAGGGATTGAACGCAGATCTCCTGCATTGCAGGCAGATT CTTTACCAGCTGAGCCACAAGGGAAGCCCAGGGTGAGGTGTAGGGACAAG CAACTTTGTTTGTATAAGAATGTTAGACCAGGGAAGAAAGAATATAACAA AACTCTATCATCATGTTAAAGGAATATTTGCTGTTGCTCTTATTATTTTT AAGAGTTTAAATGTGAATATTAACAGAAGTATTTCTCAGATACCAGGGAT CCAAGGAGGAGTACTGAATCACATACAGTCGTTGATATTTAACAAAATCT GTAAAAACTACAATTTTCAGGTTCTTGTCAGCAGAATTCCCGCTTAGATG TTAGTAATAGGCATTTGTGTGAAATTAAGTAGGTAGAAAGCAGAAGTCAT TTTTCTCTCCCAGTAGCGGCTGATATGAACCCAGGCAGTAAGTGAAACCT TCAGTGGGAGCCTGACCATCTTCAGGTCATTTTCCTCAGCTCAGCAGACA ACAGAGAGATCATAGACAGTTCACGTTTACTGGTTTCCCCAAAGCCAGCA GTGGTTCTTTCTGACCTTCACTCACCCAGCCCTTCCAATGGTCTCGCTTA AGAATTGAATTCTCTGTATTAAATCCTGTCTACCAAAATATCTAAATTCA TGACTAAACTCTGACTTATGTAATGTAGCAATATGGAAGTAAAAAGTGAA CACTAATCAATTTTAGTGAAGAAAGAAAAAAAGAAAGTAAAATTTGACCT AACAATCATGATATTTGCTTCTGGTCTAATCCCCCAAGTTTATCATGTTT ATACATTTTTATTATTCTTTATGATCATTCCCTAAAGGAAGATGTCTCCT AATAACTTTTTTCTTTTCTATACATATATATATAATTTGCTAATTCCACA CTTTGCTGGGATTAAATGAAATGCTACTAAGGCATATAATCAAGCAAGAA ACAAACTATTTTTGAGCAACTTCTAGAAACAAAAATAGATAATGGTCAGG CAGAAATTAAGAGATATGCAGAAATTGCCCTCCAATCATTCAATATAATT TTTCTGAAACTCAGTTTTCTTATAAGTAACATGAAGACAATAATATCTCA TAAAAGGTATAAGAAATAAATGAAATAATATATGGACAAATCACATTGTT ATCAGTAATTTGCAGTACAATTGATAGTTACTGTTTTTGTTACTACTATA ATGTGGATTTATAATATCTTTCTAACATTTTAATCATTATTTAAACAGAT GTGCCTTATTATGTGGTGATTTCTTCATGATAAATCTACCATAATTAAAA GATAAGTGAAGAAGATTTATTTAGCATTCTTTCTGGGAAGATTCTTATCA AAGGAATTCTACGAATACCACTGCTGGCAAATAGGAGGTTTCTGAAAATA TATTCTAAATTGGTTCCCCAGCTGTTCGTATCTCACTACAGCCACTATAA GATGCCAATGACTGCCACTTTGGTCTCTTATTCCCTCCACCTGGCCCTCA TGAAAGGCCAGCTGAATAAACCAGCTGATTATGGCTGGTGAGAAAACTAC TAATTATCCTTAATGTCCTCACAATACATTGATGACCACTAATTTCCAAT GGGCCCTTGATGTTGCTGAACTTTCATTTATATTTCTCTAAATACTTTAT GGGTTTCCCTGGTGACCCTGTGGTAAAGGATCCACCTGCCAATGCAGGAG GTATGGGTTGATCCCTGGTTCAGGAAGATCTCCTGGAGAAGGAAACTGCA ACCCGCTCCAGTATTTTTCCCCAGGAAAATCCCATGGACAGGTTGTGAAA GAGTCAGACATGACTTAGCAGCTAAACAACAACAAGCTGTTTATTTTCTT TATTGACTTTTCACACCTCTCCCACTCTTTTGAAATTTTGGCACCATCTC ATTCATTCTAGAATGCTCAGATCCTATTTAGCCTAAAAAGTTTTTCTAAA TCTAAAGGAATTTCCATCAATGGCTCTCATGTCTATATTCATATGCTTTG AATGTCTGCTACCTACAGTCTCTCTTCCTTTTTTGAAGATTGTCCAATTC CTAAAGGCAGCCTCCCCAAATTCTGTACTAGATACTATCTCTTTTGGCCC CTTCAATGACTGGAGCCCAGTAACTCTCTAAAATTTCAATTTATCCATCT CTGTTGGATCATTCCCAAGTGTGTACTAACGTGCACTTTTTTTTACTTCC ATGTTCAGAAAACATTTCCAATCTCAATTCAATCAGCAGTTACTTTACCA TTTCTCTGCTTCTCTATAATCTCTTCATGAGAATTGGCAATGCTAGGTCT CTTCTGGTCTTCTCTTCTTATTCTAACTTAAATATCCTTGAAGGAGTGCT TGCCTGCAACCATACCATCAAAATGCACTTCATCATTTCACCAATGCCTT AAGTTTGTTAAACCCAAGAGTTAATTCTCAGTTCTCATAGAACTTCAAGG ACTTCCCTGGTGGCTCAGATTGTAAAGAATCTGCCTGCAATGCAGGAGAC CCAGGTTTAATCCCTAAGTTAGGAAGATCCCTCTGGTATTCTTACCTTGA GAATTCCATGGACAGAGGAGCCTAGCAGGCTACAGTCCATGGGATCCCAA AGAGTTGGATACGACTGAGCAACTAACACTTACACTTTCTCTTATGTACA ACTTTAATACACTTGACTAGGTCCTTCCTTCCCAACTCGTCACTTGGATT CCAGGGCCTCATAATCTGTAGGTTTTCATCCTGTCACACTGTCTACTTCT TCTTCTTCTTCTTTTTGTTTTGGTTCCTTCTCATTTCTTTCAGTTCAGTC ACTCAGCCATGTCCAACCCTTTCCGACCCCATGAATCACAGCACACCAGG CCTCCCTGTCCATCACCAACTCCCGGAGTTCACTCAGACTCACGTCCATC GAGTCAGTGATGCCATCCAGCCATCTCATCCTCTGTCGTCCCCTTCTCCT CCTGCCCCCAATCCCTCCCAGCATCAGAGTCTTTTCCAATGAGTCAACTC TCTCATTTCTTTAGCCTTTTTAATATTGGGTCTTGGCCTTGGACAATATA TTAATTCACTAGGGCAGCTGTTAACAAAGCAGCAGAAACTGGGTAGCATA AATAACAAATTTATTTTCTAACAGTTTTGAAGGCTAGAAGTTTGAGATCA AGCTGCCAGTGGGTTGGTTCCTTCCAAGGGCTGGGAAGGAGAATCTGTCC CTCTGTCCTAGGTTCTGACGTTCCATGTTTTGTAGAAAAATTATCTCATC TCTGCTTCCACCTTCATGTGGCACTTCCCTCTGTCATGTCTGTGTCCAAA CATCTCCTTTTTATAGGGACACAAATCATACTGGATTCACGTAAGTGCTA AGTCACTTCAGTCATGTCTAACTCTATGCAATCCTATGGGCTGTAGCCTG ACAGGCTCCTCTGTCTTGTCTGGGGTTTCCCAGACAAGAATACCAGAGTG ATTGTCATGCCCCTCTCCAGGGGATCTTTCTGACCCTGGGATGGAACCTC CGTCTGGCGTCTTCTGCATTGACGGGCTGGTTCTTTACCACTAGTGCCAC TGGGAAGCCTGTATCAGATTAGAGGTCCACCCTATCCAGTATGACCACAT CTTAATTAATTACATCTGCACTGATCCTTGGAGAGGGCAATGGCACCCCA CTCCAGTACTCTTGCCTGGAAAATCCCATGGACGGAGGAGCCTGGTGGGC TGCAGTCCACGGGGTCGCAGAGAGTTGGACACGACTGAGCGACTTCACTT TCCCTTTTCATTTTCATGCATTGGAGAAGGAAATGGCAACCCACTCCAGT GTTCTTGCCTGGAGAATCCCAGGGACGGGGGAGCCTGGTGGGCTGCTGTC TATGGGGTCACACAGAGTCGGACACGACTGAAGCGGGTCACACAGAGTCG GACACGACTGAAGCGACTTAGCAGCAGCAGCGCTGATCCTATTTCCAAGT AACATCGCTTTCTGAGATACTTCAACATATAAAACTTTTGAGAGGGACAT AATTCAAACCAAGACAAACCATTTCTTGAACATGTATTTTGCATATCTCA TCAGCAGCAGCAGCATCTAGATTTATGCTTTACATTGTGTCTAGGCACTA AATACTACCTAATTTATACCCCAGGTTAGACTTCTCTAAATTCCAGGCTC AAATATCCAAAAAATATTTTCAATATCTCTGCCTTGATATATGATAGGCA TCTCAGACATAAGAAGTCTTGTAAAATAAAGTCTCACATAATCTCAAACC AGGCCAATAACATAGACCATAACAAGCACCCTAAAGCCTCCCACATGTCT AATAAGTATCCCCAATTACTGTTCTCTCCCCTCTCCAGAAGTAAATAATA CTCTGACTTTAATGATATTCACACCTTTGCTTTTAAAATTATGATTATCT AAACAATATCATCTAATATTACAATTTTTTGAATTCACATATGATTGAAA TTATCTGTCTGTGCCTTTCTTCTTTCATTCAAACTATATCTTTAAGGTTT TTTTCAAGTTATTGCTTTTCACCAGGCTTTACTCAGTGTTTCTCATACAT AGTATTTATTCATAGTATCTCATAGCAAAACTCTCATGATTTCTTTGTCT TCATATTTTAGCCATTATAAACATTGCTGTTATGGACATTCTTGAACGTA TACCCTGGTGCAAAATAGTATGAATTTCTATGGCTATAGGCAAACAGAAT TATACTGCCATAGGTATGTTTGTCTTCACTTGTACTGAATATCGCAAAAT ATTCTTCAAATTTGTTCTATCCACATTTGGTCAGGAAAATGGAAGTCATT GTCTCTATTCCATAGATGAGGGGTTTATGTATCAAAATCTACTTTTCATT GTATCAAAAGTAGCAAAAATTAAGAAATTGAAGAAATCACCCAAACAACC ACCCAAGAAACTGAAGAAGCCACCCAAACAACCACCCTCATAGAATCCTT ATGTTAAAAGCAGGTTAGGAAAAACTCAGGGTAGTCAAATATGAACATGA GTAATAAAACTACAGTCTTCTTAGCACAATTATGTAAAGAAAACAACCTA AAACTGGAAAATGAGAAGGGAAATATTTGGCAGACAAAATAAATTCAGAA AAATACTACCTCAAAACAGAAGGAATATAACAAAGCAGTGTTATTTAGTG TGGTATATATATTGCATTAATGGTTCTAAATAGTGTTTCCTCCCTTTCTG GCTCTAAACCAGGCCAAGTGACTTGCTTTAATCAATGAGAAGTTAAAAAT ATGGTATAAGCAGACACTTAATAAAATTCTTGTGCATTTCTAATTGCTCT TTTTGCCCTTGCTATGAGAACAAGCACATGATAGCCTACTGAACAATGAG AGATCACATAAGCAGATATTAAGCATTAGCTGAGCCATCATAGCTCCAGC ATGCCTGCCAGCATGACAAAGACAAAAATGTAAAATGATCTTAACCTGGT CCAAAAAAGCAGGACTGAGATGCTGGCCCATAAATTTGTTTTAAACCACT GAGTTTTGAAATGATTTGTTATACTGTATTACTGTTGCACTAAATAACCA GTATAACCACCATAAAAAAGAAGTATAAACACTCGGAAAAGAGAATGTCA AGATCTGTGAAATGGAAAGGCAGAAAATAAATTGGAAAAAAAATGACAAA AATAACTTCATAAATGAAAACATAATTATGAGATGTATAGAGGAGATTAT ATAGGATCAAAAGTACTTTAGATAACTAGATAAAACTACAGGCAAATGAA CAGAAATTAAGAAGAGATATAAAAAATGGATGAAAGAAAACACTAGATAC GAAAGATAGGCAATGGATCCCTAATATGCATATATTTAATAGTCTGAAAT TTTAAAAATAATAGATAATTTTAAAATATCTCATTTCTTTTATATATATT AGAGGGTTTCCCTGTGTTTCCCAGGTGTGAATTTATTTATGATCAACTGG GCTTCCCCCACGTTCAAGGTAAGAGAAACTCAAGTGAGACAGTAGGTGTT GCACGAGGGAAACAGAGGGCAGATACACTGAAACCGTAATCACAGAAAAT CCGGTACTCTTGCCTGGAAAATCCCATTGAAAGAGGAGCCTGGTGGGCTG CAGTCCATGGGGTCACTAAGAAAGGACTGAGCAACTTCACTTTCCCTTTT CACTTTCATGCATGGAGAATGAGAACTACGTCCCTCATGGCCC project fbnw AI 20040830 8044bp GGGGCATCGATGGTACGTAGTTCATCATAAAGTTTATGACAGGTACCTCA CAATAGGTTGTAGATTATGTTGCCTATTTCCTGTGATAAATAATGCTGGA TGTGAACATGCACTTGCTCGTATGATTATAAATGCCATGAGCTAAATTGA CTATAAATGACTTTATATTACCTAGCATGGAAATACTGTCATTTTTTACA TGAAAAGTAATTTTAAAAAGTCATCTGGTATAAAGACTCAGGATTTAGCA GTTTTACCAATTGAGTAGAAGAAATCTCCAACACAATCAAATAAAATATT AATCTGGGTGTTTTGCAGTTTTTCCTGTATCACATTCTTAAGAAAATTAC TTTGAATAGTAAAAGGATAGCTATTATAATGCAATGTAAAATACATAATT GTTGGTCTGAGAGTAATACAGTTCATCTACGTGATCTATGAGAGACAGTC AAACTGTTGGACACATTCAAACAAAATATGGCTGTAATTCCCCTCATATC TCTCCCAACAACTCCTTAGTCTCCTTCCAGCAATTAGTGGCCATTTTATC TTGATTTATCTTTTGGATGTTGGTAACAGTTGGACTGTGAAGAAAGCTGA GCACTGAAGAATTGATGCTTTTGAACTGTGGTGTTGGAGAAGACTCTTGA GAGTCCCTTGGACTGCAAGGAGGTCCAACCAGTCCATCCTAAAGGAGATC AGTCCTGGGTGTTCATTGGAAGGACTGATGCTAAAGCTGAAACTCCGATA CTTTGGCCACCTCATGTGAAGAGTTGACTCATTGGAAAAGACTGATGCTG GGAGGGATTGAGGGCAGGAGGAGAAGGGGACGACAGAGGATAAGATGGCT GGATGGCATCACTGACTTGATGGACATGGGTTTGGGTAGATTCCAGGAGG TGATGGACAAGGAGGCCTGGTGTGCTGCGATTCATGGGGTCGCAAAGAGT CGGACATGACTGAGCGACTTCACTTTCACTTTTCATTTTCCTGCATTGGA GAAGGAAATGGCAACCCACTCCAGTGTTCTTGCCTGGAGAATCTCAGGGA TGGGGAGCCTTGTGGGCTGTCGTCTCTGGGGTCGCACAGAGTTGGACAGG ACTGAAGCGACTTAGCAGCAGCAGCAGAAATTAAGTTAATGGGTCAGAAA GGAGACTTGACGATGAAAAGTACAGAACTTTGTAATCACTTGGAAAAGTT GTGACAACAACAGTTAATTGGAGAAATCAGTTACACTATTGTATTTGTAT GGCAGGCTGGTAGTATAGGTCATAGTACTAACATATATATAAGAAGAAAA CAAAGATTTAAATACAATTACTTTATAAGTTCATGAAATTAGACTAATGT TGATATACAAAAGCCCATTTGTACATATAGATACAGAATCTTCTGAGCAG TAATCAAATATTTTGATTTGCATCGAACTTTTTTTCATAGATGCACTTAA AAAATGCATGTAAGCATTTTTTTAAATGCTCAATTTGCATTGAGCTAGAA ATAGGTTCTAAAAAGGAACAGTGTCATGCATGAATAAAATGTTTTAGCAT TTACTTTAACAAAAACATAATAAAAGCCCAAGGTTTATAAACTTGGGCTA CTTGTTATTTATTACAGAGAGTAATACAGACATATTCCCCCAATGTTGAT CTTTTCAATATAGTGTGAAAAAAACTGGTCTAATGTTAATAAAGAACAGC GTCTTTACAAGATTTATGCCAGTGTGCTTACTAACTAATGAGCTTACCTG TAGATTCTTGGCATTTTTTATTTCCTCCATACAATCTTTCCATTCCCAAT TGCCACAAAACTTTCATCAACAATTGTATCCTTTGAAGAGAACTTTTCTT TCAGTGGGATGTATGAAAATGTAGGATGACTTCTCCAAAAGGTGGCAACT CCCTGAAATCCAAGAATATTGCCAATGAAAATGAGGTCAATGAAGAGAAA GTGAACGAAAATATACATTTTTTATAAAATAGCTAGCTTTTTCTAAACTA TATGCAATTTCAGTTCAGTTCAGTCACTCAGTCGTGTCCGACTTTCTGCG ATCCCATGAATCGCAGCATGCCAGGCCTCCCTGTCCATCACCAACTCCCG GAGTTCACTCAGACTCACATCCATCGAGTCAGTGATGCCATCCAGCCATC TCATCCTCTGGCGTCCCCTTCTCCTCCTGCCCCCAACCCCTCCCAGCATC AGGGTCTTTTCCAATGAATCAACTCTTCGAATGAGGTGGCCAAAGTACTG GAGCTTCAGATTTAGCATCATTCCTTCCAAAGAAATCCCAGGGCTGATCT CCTTCAGAATGGACCGGTTGGATCTCCTTGCAGTCCAAGGGACTCTCAAG AGTCTTCTCCAACACCACAGTTCAAAAGCATCAATTCTTCAGCGCTCAGC CTTCTTCACGGTCCAACTCTCACATCCATACATGACCACAGGAAAAACCA TAGCCTTGACTAGACAAACCCTTGTTGGCAAAGTAATGTTCTGCTTTTGA ATATGCTATCTAGGTTGGTCATAACTTTCCTTATATGCACAAATACTGGA GAAGGAAGTGGCTACCCATGCCAGTATTCTTGCCTGGGAAATCCCCTGGA CAGAGCCCCTGGTGGGCTACAGTCCATGGGGCAGCAAAAGGGTCAGACAC AACTTAGCACCTTAGCACATACACAAATATATTCCGTAATATTTAAAGTT AGAAAATTTTCATCAGGTTTCATGCATCCTATTATCTTCTACATGGTCAT TAAAGAGTACCACAGAATTTATCTTTGAAAACTAAAAGGAAAGTGGTATA AATGCCACTAAACTGCCGATCATGTCAATTGTTTTACAAAAATCATCACC TTTACTTAGAGAAAGCACAGAATTTCCAGTCTGTGGAAATTGTCAGTGTA TCTCATGGAATTAATAAAATGGTATTAAGAGAAGGAAATATTTTTTTTCT TTCAAATATTCAAATTATATTCAAATTTTCTTTCAAAACTTCAAATTATA TTTTAGAACTCGCTTATGCTAATTTCAGTAAATGGAGCAATAATTATAGA ATTTGCCTTTTGTATGCTTCAGTTTAGCTAAGCTTCATGTGTGTACCCTG CTCTGGAGCTGTATTTATAAATATATATTTCCCATTCACACTCTAAGTAA CACTTGATATATCTAAAGAGCTGCTGTGTATTCTGAGGCATGTACAAAAG CAAATTTAGAATGCAAGGTAAAATTTCCATTCTATCTAGTTTAGAATAAA CTTAAAAATATTTTCTAGGTGGTTTTGCAATTTTTATAAGCTGACCATAA TAATTCAGAAGCTTTATTTCTTTCACTTAGCTTTGATATTTTTGAATTAA AGGATGACCAAGAAATAAAAACAAACCCCCAAAAAACCTTTTACATCCAT CTGTTAAAATACTTGATAGATCATAATTGAAATATGTCTAAACAGCTGAT AAAAACTGATCCTAAGAGTGTATAAGTTGACAACAGATTTTTCTTAGAAA AAAAAAAATTAACTAAAATTTTTGAATACATCCATAATTAAGGTAGACAA CTTCTGAAATGGCTCCCCATGGTCCCTGCATGTATGGATGTGAAAGTTGG ACCATAAAGAAAGCTGAGCACCAAAGAATTGATGCTTTTGAACTGTTGTG TTGGAGAAGACTCTTGAGAGTACCTTGGACTGCAAGGAGATCCAACCAGT CCATCCTAAAGGAAATCCATCCTGAATATTCATTGAAAGGACTGATACTG AAGCTGAGCCTCTAATACTTTGGCCACCTGATGGGAAGAGCCGACTCATT GGAAAAGACCCTACTTTTTTGAAAAGACCCTAATGCTGGGAAAGACTGAG GGCAAGAGGAGAAGGGCCCAACAGAGGGAGAGATGGTTGGATGGCATCAC TGATTCAATGGACATGAATTTGAGTAAACTCTGGGAGAAGGTGAAAGACA GGGAAGCCTGGTGTGCTGCAGTTCATGAGGTCGTGAAGAGTTGGACACAA CTGAGTTACTGAACAATAATATAATTGCAGTAGTGTTGGTCACTCAGTCA TGTCCAACTCTTTGCAGCCCCACCAGCTGTAGCCTTCCAGGCTCCCCTTT CCATGGAATTTTCTAGGCAAGAATACTAGAATGGATTGCCATTCCTTTCT GCAGGGGAACTTCCCAACCCAGGGATTGAACCCAGGTCTCCTGAATTGCA AGCAGATTCTTTACTGTCTAAGCTACCAGGGAAGCCCTAATTGTGGTAGA CAACTTCTAAAATGGCTCACCATTGTCCCCGCCCCCTGGGTATTTATACC CTTGAGGAACCTCCCTTTGAGAGTAGACTTGCTTCCAATGAATAATATTC TGGAAAAGTGATTGGATGCCATTTCAGATACTAGATTACAAAAGATTGTG ACTTCTATCTAGTTAGAGCCCTTTTTTGCTTGTCCTGACAAAGTCAGCTG TAGTCTTCTGAACCTCCCTATGCAAAATCTCAAGGGCAAAAAAGTGATAG AAGCTTTCAGCAATAGCTGTCAAGGAATTCGGGCTCTCAGTCCAACAGCC TGAGAGACACTGAATTCTATTAACAACCCCAGAGAGAGCATCTAACCAAG TTGAACTGTGAAATGACCATGGCAGGTCAAATCTCAGTTACATCATTGTA GGAGACCCTGAACCTTCAGTTCAGTTCAGTGGCTCGGTCGTATCTGACTC TGTGACCCCATGGACTGCATCACGCCAGGCCTCCCTGTCCATCACCAACT CCCACACTTTACTCAAATTCATGTCCATTGAGTCGGTGATGCCATCCAAC TATCTCATCCTCTGTCATTCTCTTCTCCTTCCACCTTCAATCTTTCCCAG CATCAGGGTCTTTTCCAATGAGTCAGTTCTTCCCATCAGGTGGCCAAAGT ATTGGAGTTTCAGCTTCAGCATCAGTCCTTCCAATGAATATTCAGGACTG ATTTCCTGTAGGATGGACTGGTTGGATCTCCTTGCAGTCCAAGGGACTCT CAAGAGTCTTCTCCAACACCACAGTTCAAAAGCAACAATTCTTCAGTGCT CAGCTCTCTTTACAGTCCAACTCTACTGGAAAAACCATAGCTTTGACTAG ACAGACCTTTGTTGGTGATGCAATATCTCTGCTTTTTAATATGTTGTCTA GGTTGGTCATAGCTTTTCTTCCAAGGAGTAAGTGTCTTTTAACTTCATAG CTGTAGTCACCATCTGCAGAGATTTTGGAGCCCCCAAAAATAAAGTCTGA CACTGTTTCCACTGTTTCCCCATCTACTTGCCGTAAAGTGATGGGACCAG ATGGCATGATGTTTGTTTTCTGAATGTTGAGTTTTATACCAACTTTTTCA CTCTTCTCTTTCACCTTTATCAAGAGGTTCTTTTGTTCTTCTTTGCTTTC TGCCATAAGGGTGGTGTCATCTGCATATCTGAGGTTATTGATATTTCTCT TGGTAATCTTGATTCCAGCTTGGGCTTATTCCAGCCCAGCATTTCTCATG ATGTACTCTGCATAGAAGTTAAATAAGCAGGGTGACAATATATAGCCTTG ACTCACTCCTTTCCCTATTTGGAACTGGTCTGTTGTTTTATGTCCAGTTC TAACTGTTGCTTCCTGTCCTGCACCCAGATTTCTCAGCAGGAAGGTCAGG TGGCCTGGTGTTCCCATCTCTTTAAGAATTTTTCAGTTTGTTGTGATCCA CATGGTCAAAGACTTTGGCATAGTCAATAAAGCAGAAGTAGATGTTTTCC TAGAACTCTCTTGCTTTTTCTATGATCCAACAGATGTTGACAATTTGATC TGTGGTTCCTCTACCTTTTCTAAATCCAGCTTGAACATGTGAAAGTTCAT GGTTCACGAACTGTTGAAGCCTGACTTGGAGAATTTTGAGGAGGGTCCCA TATAAACTATGCCCAGATTCCTGATCCACAGAATCTGTGAACTAATACAC ACGTGATGTCTTAAGCTGCTAAATTTTCAAGAGCTTGTTGTGCTGCAATA CATCATTAATATGATAATTGATATAAATAAGTTTTAGTTTAGGTCACTAA TGATGTTCTATTACATAAAATGGTTACAAGGTGTTTTGTTTCAATGCTCT CTACTTTCCATTCTTTGTTTCCATGTCTGTGAAATGAGAAATAATGTCTT GACTATTGTTTCCAGATCTAAATTTTATCTTATCTACATAATCCCATGAC TAAATTCACATCTAGTCTTGATGTCAAAATAGAAGATAAGAATTGTAAAG ATTACATGATATTATGCATGGAAAAGTACCTAGCTCCATGCTGTTCACTT TGAAAGTGCTCAGAACATGTGAGAAAATAGATGTTTGCCACAGGATGAGA TGAAGGGAAGTAAGCCTGGCTTCCAGCTTAGCTATTTCTTTGGTTCATTT GGGTTTATCTGATTTGGTAAGTAGGAGTAGTTTTGGGCTAAAGTCTTCAT AGGATCGGTGAAAAAAAATCAGTCCTTCAACATCTTTCAGAGATGTTTAT GTTACATTCACTGTTTTTTAATTTTATTTAAGATCAATTCTTAGACTTTC TGTAGGAAAATGTTTAGAATGTCAGAATAAAAATAAAAGTGTGAAATACA CATTCGCAGTCTTACATTTTCAAGTTTAATAAGAACATGATTCTAACAGG GATATAAGTTGAAAAGCTGAAAAGGGGTGGGGAGATGAGGAAGGAATAGT CTGTTTGATTTTTATATTTTAAGATTCAAAAGTTTAGAAGCACTGGCCTC ATGATTTACATAATTTCTCAGATGCACACTGACCAGGATTCCTCTGTAGA ATAGTTACATGAAAAACTCATTTTGCAGTATTATTGATTAAAAATGGCTG CAAATTATTTTAATTATTTGCTGCTCTTTCTGTTGAGAGGTATAGGAGAA ATTCATCTCTCTTTAAATCAAGGATGGACCTTCCAGCTTGCTTGGCAAAA AGAACTTGGCAGAAATGATGTGGGACTTTCAAAGCCAAGAAGCCTTTCAA CTTCCATTCTGATGTCTTATTATACATGCTGTAGGTGAAAACAACAGTCA TGTAAGAAGTCTAGCTACCTTAGACCACCGTCCTGGAGAGATGACACATA AGTCCACAATGTAAGCTGAGTTCAGCTTTCTAGCTGTTTCTATCAGTAAC TAGACATGTGAGTTTACCAATCTGGACCCTACTATCATTAAAAATGGAAG AATTACCCAGCTGAATTCTTCCCTGATTTTTGGTGAACTGTGGTAAAATC ATAGTTATTTTATGGCAATTAATTTTGGAGTAGTTAGATATTCAGCAATC ATTACCTGGAAACATCATCATACTCATCTAGTTTTAATTGTGTTTTAATG AGCAACTAAATGCATTAGTGGTCTCAAAGTGAAAAAATATTTTGTAACAT TATTTAGAAGTGATAATTTAGGTTCCAAATTACATGAGTGTTATTGGACA CCCAGAGAAAAAATCATATAGAAAAAGAATCAGTAAAATTGAAGGATTTT CATATTATATGACTTTATAGAATTTGTATATTTCTACTTTGAGTCACCAT GGGACAAAATGTAAAAATAAATAGATATACACGCATATATATGTGTTTAT ACTTGCATGCATATTTATATATATGCTGTGCTGTGCTTAGTCACTCCAGT CATGTCTGAATCCTTTGAAACCCCTTGGAATCACCAAGCTTCCTCTGTCC ATGGAGGATTCCTCCAGGCAAAAAAAATTGGAAGGGGGGTTTGGCCATGT CCTCCCTCCCAGGGGAATTTCTCCAAATTCAAGGATCTTAAACCAAGGAC CCCCTGGATTGGCAGGGGGGGGTTTGATGAGAATATAAAAATATAGAGAG TAAAACACGAAAATCGAAAGGAAAAGTAGATCAACATACCCCATTTTAAC CAAAAACCATTCATATGACCCAGAAATCCAAATTGTAGATATACCTTAAC AGAGACCAGACACTATGCGATGAACAAGAGAAAACAGGCATGAGGAACAA TGCGCGTGACTCAGTACAATTGTGGATGATTATTTTATTATATG project fbnw AJ 20040830 7766bp GGGGGGATGATGCAGTAGTTCATCTCAACATGTTGAACTTTGCCAGAATT CTATCACCTTAGAAAATACCATTGTTGATAAAACTCCCCCCCCCCACTTT TTCTGTTCACCTTAAATGCTTACTTCAAAGAAACATTCTTCCTCATGTGA CTTCAATAAGTCTCCTAGAAAACTCTCATTTTACTCTATGAAAAGACCAT GTCCTGGTCCTCAAAATGTCCATTCTTTGCCTCATCAATGATTACTGAGG TGTTAAGAAGATCAGTCCTGGGTGTTCTTTGTAAGGACTGATGCTAAAGC TGAAACTCCAATACTTTGGCCACCTCATGTGAAGAGTTGACTCATTGGAA AAGACTCTGATGCTGGGAGGGATTGGAGGCAGGAGGAGAAGGGGACAACA GAGAATGAGATGGCTGGATGACATCACCGACTTGATGGACAAGAGTTTGG GTGAACTCCGGGAGTTGGTGATGGAGAAGGAGGCCTGGTGTGCTGCAATT CATGGGGTCACAAAGAGCCGGACACGACTGAGCGACTGAACTGAACTGAA CTGAACTGAATCCTCCTTGATAAATCAGAACCAAATGCTCTTTAACTTGA CCAATTCTCTCCTTTCTCAGAATACCTCTCCAATTTTACAGTAAATGTTA AGATCACAAAATTGAACAATTTTAAACAAAAACATAAATTTTCTGTTGTC CAACTTTTTGTGAATGATGCATTTCCTGGTTCAAGGCTGTACTGTATTTA TTGACAATATTGCACATATTGCTAAGCTAAGGAAACTCTAGGAACAAAAT AGATGACTACATGAGAAAAGTAATAATTAGGGGACTGGAATGCATTTCTC TAATAGCCTAACAGGTAAAAGGTAGAGTGTCAGTCAAGAGCATTGCTGCT GCTCCTGCTAAGTTGCTTCAGTCGTGTCCAACTCTCTGCGACCCCATACA CGGCAGCCAGCTAGGCTCCCTTGTCCCTGGGAGTCTCCAAGCAAGAACAC TGGAGTGGGTTGCCATTTCCTCCTCCAATGCATGAAAGTGGAAAGTGAAA GTGAAGTCGCTCAGTCCTGTCTGACTCTTAGCGACCCCATGGACTGCAGC CCACCAGGCTCCTCCATCCATGTGATTTTCCAGGCAAGAGTACTGGAGTG GGGTGCCATTGCCTTCTCCACAAGAGCATTAGAGGACTTTAAATAAAATA CCTCAAAGGAATGATTAGTAGAAAGAACGCAAGCCTAGACAAAAGCTTCA GTGACTTAGTTACCTGGAAGAAGCCCAAGCACAGGTTGCAACTTGAGATA ATGTACATTAATATGTAATTTTAATATGCAGCCCAATGGGAGCTAATTTG CATGTTATAATTACCTTTCCAACTGTCTTTCATGAGATAAATATACAGCC ATTAACAAAACTTTAATGTATCACATTTTTTAACTAAATAAATTTGCTTT ATGATATTGCTTAATCTTTCTAAGAAAATGGCAAAACCCGTTATGCTTTA TTAAGCACAAAGAATTAGGAATATTTGAAGTTTTGATTTTTAGCATGGAA GAATACTTCATAGCAGTAGTTAAATTAATGACATTGTTTTCCAAATAGTT GCTACACAATAACTCTTGTCTTATTAAAATTATTATTTTTAATTAAATTA AGCCTTGGTTTGTGTGAAACTAGCTTTGTGGCAATCAAGATGAGAAATGA CAAGAGCACAGGAAGTGGAAAGGGAGATTAATGTTTATACTGAATTCACC TTCTGATATGTCAGTCTCTATCATTTCTGGGAAAAGTGGGGAATCAACCT GCTTATATGCAAATAGAAATGCTAAATAATTATGTTCTTCACCCTCTGGG ATTAGTAAATAAACACCCAGATACACACCCACACCACACACACACGTGCA CATGTGTATGCGTGCACACACACACATATACACACTGGAGAAAAATTACA AGGAAAATATACTTGAACCAAAAGTTATTTTCAGCAGGTACAAATCAGGG ATAAAAGGCCTTTTAGGAGGATTTGCAAAATAGCTGAAGAAAGAAGAGAA GCAAAAAGCAAGGAAGAAAGGGAAAGGTGCATCCAACTAAACACAGAGTT ACAAAGAAAATCAAGGAGAGACAAGGCCTTCTTCAATGAACAGCGCATAA AAATAGAGAAAAACAGATGGTGATAGATTATAAACCTCTTCAGGAAAATT GGAAATATCAAGGGAACATTTTGCCCAAAGATGGGCACAGTAAAGGTCAG AAATGGTAGAGACCTTATTAGACTCAGAAGAGATCAAGAAGAGATGGAAA GAATACACAGAAGAACTGTACAAAAAATACCTTAATGAACTGGATAACTA TGATGGTGTGGTCTGTCACCCAGAGCCAGGTATTCTAGAGTGTGAAGTTA AGTGGGCCTTATGGGCCTTATGAGGCACTGCTGTCAATAAAGCTAGTGAA TTAGATGGAGTTCCAGTAGAGCTATTTAAAACCCTAAAGAATGATGATAT CACAGTGTTGTATTCAATATGCCAGCAAATCTGGAAGCACCAGCAGTGGC CACAGGACTGGAAAAGGTTAGTCCTCATTCCAATTCCCAAGAAGGGTAGT ACTAAAGAATGATTAAACCATCAGATAATTGCTCTCATCTTCCATGCTAC TAAGGTCATGCTTAAAATATTGCATGCCAGCCTTCAGGATTATGTGAACC AAGAACTTTCACATATTCAAGCTGGGTTTAGAAAAGGCAGAGGAACCAGA GATCAAATTGCCAACATCTGCTAGATCATAGAGAAAGCAAGGGAATACCA GAAAACCATCAACCTCTGTTTCACCAACTACACTAAAGTCTTTGACACTG TCGATCATTAAAAACCTGTGGAAAGCTCTTATAAAAATAGGAACACCAGA CCATCTTACCTGGCTCCTGAGAAATCTGTATGTAGGTCAAAAAGCAAAAG TTAGAACCTTGTATAGAACAACTGATTGGTTCAGGATTGAAAAAACAGTA GTATGACCGGACTGTCTGGTGTCACCCTTTTTATTTAACATATATGTTGA GAACATCATGAGAAATGCTGGGTTGTTTGAGTTGCAAGCTGTAATCAAGA TAGGCAGGAGAAACCAACAACCTCAGATATGCTGATGATACCAGTCTAAT AGCAGAAAGTGAAGAGGAACTAAAGAATCTTTTGATGAAAGTGAAGGTGA AGGAGGAAAGTGAAAGAGCCAGCTTAAAATTAAATATTAAAAAAACTAAG ATCATGACATCCAGCCTCATTACTTAATAAAATAGAAGGGGAAAACATAG AAATAGTGATTGATTTCCTCTTCTTGGGCTTTAAAATCACTCCAGATGGT GACTGCAGGCATGAAATCAGAAGACAATTGCTTCTTGGCAGGAAATCTAT GACAAACCTAGACAGTGTGTTAAAAAGCAGAGACATTACTCAGCTGAAAA AGGTCTGTATGTCAAGGCTATGGTCTTCCCAGTGGTCACATACAGTTGTG AGAGCTAGACCATAAAGAAGGCAGAGGGCCAAAAAATTGATGCCTTTGAA CTGGTGCTGGAGAAGACTCCTGAGAGTCCCTTGGACAGCAAGATCAAACC AGTCAGTTTTAAGGGAAATAGACTCTGAATACTCATTAGAAGGACTGATG CTGATGCTGAAGCTCCAGTGTTTTGGTCATCTGATGTGAACAGCCAACTC TTTGGAAAAGTCCCTAATGCTGAGAAAGATTAAGGGAAAAAGGAGAAGAG GGCGTTATAGGAAAAGATGGCTGGATGGCATCACCAATGCAACGCATATG AACTCCAGGGGATGGTGAGGGGCAGGGACTCCTGGTGTGCTACAGTCCAC AGGATCACAAAGAGTTGGACACGACTAGACAACTGAGCAACATGAATGAC AAGCAACTTATCAACATATAAGTATAAAAGATGTGTTATTTTGACAAATT ATGCCCCGCCTGATATGTGATCTGATATGCAACCTGCCCATTTTACATTA CCACTCTAATTCTGCCCTACTGAGGTCCAAAGTGATCTGTGTTCTAATTC ACCTGTTGAGGTCCCTCCCTATGGACGGCCAATTAAAATGAACCAACATG TGGCGTTATACATGATAGCCAAGATAACCTAAACACTCATCAATGGATGA ATGGATAAAAAAGACGTGGCATATACATACAATGTTACTACTCAGCTATA AAAAAGATGAAAGCTTGCTATTTTCAACAATGTGGATAGACCTTGAGGGT ATTATGCTAAGTGCAAAAAGTCAGATGGAGAAAGAAAAATACCATATGAT TTCACTCATACATGGACTCTAAAAACAAACAAGTGAGCAAAACAAATTAA CAAAACAAACAGAAAGAGAAGATAGAGTAGTGGTTAACAGAAAGGAAGAG GTGGGGGAGAGTGAAACTGGAAAAGGGGATCAACTGCATGGTGATGGATG AAAACTAAATTTTGGTGATGAACATGCTGTAGGGTATAGATAAGTAGAAA TATAATGTTGTACATATGAGATTTATATAATATTTTAAACCAATGTTACC TCAATGAAAAATGTCTAAAAAAAAAAAAAAAAAAAAACACCAACATGGAT TTCCACTTCTACCTTCACCTCAGAGTGGATAGTGATCTTTCATTGCAGTC TTAGCTTGCATTCCTCAAATGGTTGATGTTCAACATTTAATCATGTGCTT ATTTGATGTCTGTATATCCTAGTCAGAATAATGTCTATGTATAGATAGCA TATTGAAAAGCAGAGACATTACTGTGCCAACAAAGGTCCGTCTAGTCAAG GCTATGGTTTTTCCAGTGGTCATGTATGGATGTGAGAGTTGGACTGTGAA GAAAGCTGAGTGCAGAAGAATTAATGCTTTTGAACTGTGGCATTGGAGAA TACTCTTGAGAGTCCCTTGGACTGCAAGGAGATCCAACCTGTCCATTCTA AAGGAGATCAGTCCTGGGTGTTCTTTGGAAGGAATGATGCTAAGGCTGAA ACTCCAGTACTTTGGCCACCTCATGCGAAGAGCTGACTCACTGGAAAAGA TTCTGATGCTGGGAGGGATTGGGGGCAGGAGGAGAAGGGGAGGACAGAGG ATGAGATGGCTGGATGGCATCACCGACTGGATGGACGTGAGTCTGAGTGA ACTCCAGGAGTCGGTGATGGATAGGGAGGCCTGGCGTGCTGCGATTCATG GGGTCGCAAAGAGTCAGACATGACTGAGCGACTGAACTGAACTGAACTGA TGGGTTTTGCTCATTTTCTAGGTGGATAATTTGTTTTTTAATGCCAGGTT TTGATGGCTTGAAAAATATTATTTGGATACTAGTCCTCTGTTGAATATAT CATTTGAAATTATTTTCAACAAGGGTTTCTTTTTTTTTTTTGTACTCTAA TCAGATACTCTTGCTACACACTATGCCAAATGAATGAATGTTCCAGAATT GGTACTCAAAGGTTAACTGAATAAATTAATGAAAGCAATAATATAATTAC TAGCATATCAGGAAGTCTGTAAGGATCCTGATGATAACATAATGATTAGA AGACAGGGTTGGTTATATTCTATTTGCTGAATTATAGAGGGTAGAGGAGG AGTAAGGAAAAAAAAAAAACAGGGAAAGAATTTTTATTATTTAAAACAAT CCTTTAAATGGCACTTAGTTTAGAAAGGTTTTCATACTTCACTCACACAT TAAAAAAAAAAAAAAATCCTAAACTGGAATTCCAATTGAGCTATTTCAAA TCCTAAAAGATAATGCTGTGAAAGTGCTGCCAGCAAATTTGGAAAACTCA GCAGTGGCCACAAAACTGGAAAAGGTCAGTTTTCATTCCAATCCCAAAGA AAGACAATGGCAAAGAATATTCAAACTACTGCACAATTGCACTCATCTCA CACGCTAGCAAAGTAATGCTCAAAACTCTCCAAGCCAGGCTTCAACAGTA CATGAACTGTGAAGTTCCAGATGTTAAAGCTGGATTTGGAAAAGGCAGAG GAGCCAGAGATCAAATTGCCAACATCTGTTCGATCATCAAAAAAGCAAGA GATTCCAGAAAAACATCTACTTCTCGTTTATTGACTATGCCAAAGCCTTT GACTGTGTAGATCAAAACAAATGGGGGAAACTCTTCAAGAGATGGGAATA CCAGACCACCTTACCTGCCTCCTGAGAAACCTTTATGCAAGTCAAGAAGC AACAGTTAGAACTGGACATGGAACAACACACTGGTTCCTAACACGGAAAG GAGTATGTCAAGGCTGTATATTGTCACCCTGCTTATTTAACTTATATGCA GAGTACATCATGCAAAATACCAGGCTGGATTAAGCACAAGCTAGAATCAA GATTGCTGGGAGAACTATCAATAACCTTAGATATGCAGATGACACTACCC TTATGGCAGAAAGTGAAGAGGAACTAAAAAGCCTCTTGATGAAAGTGAAA CAGGAGAGTGAAAAAGTTGATGTAAAACTCAACATTCAGAAAACTAAGAT CATGGAATCTGGTCTCATCACTTCATGGCAAATAGATGAGGAAACAATGG AAACAGCAATAGACTATTTTGGGGGGCTCCAAAATCATGGCAGATGGTGA CTGCAGCCATGAAATTAAAAGATGCTTGCTCCTTGGAAGAAAAGCTATGA CTAAACTAGACAACATACTAAAAAGCAGAGACTTTGACAACAAAGGTCTG TCTAGTCAAAGCTATGGTTTTTCCAGTAGTCATCCAACTCTCAGAGTTGG ATTTAAAGAAAGCTGAGCACTGAAGAATTGATGCTTTTGAACTGTTTTGT TGGAGAAGACTCTTGAGAGTCCTTTGGCTGCAAGGAGATCCAACCAGTCT AACCTAAAGGAAATCAGTACTGAATATTCATTGGAAAAACTGATGCTAAG GCTGAAACTCCATTACTTTGGCTACATGATGAGAGGAACAGACTCATCAA AAAAGTCCCTGATGTTGGGAAAGATTGAAGGCTGGAAGAGAAGGGGACGA CAGAGGATGAGGTGGTTGGATGGCATCACTGACTCGATGGACATGAGTCT GAGTAAGCTCCAAGAATTGGTGATGGACAGAGAAGCCTGTCGTGCTGCAG TCCATCGGGTTGCAAAGAGTTGGACACAACTGAGTGAATGAACTAAACTG AAATAACCCAATGGCATTTATTCATTTGCACAACAGTCAAATTACAAATT CCTACTGAGTATGTATTCTGTACCTGGCACAAGGCTGGGTGGCACACAGA TAAGAAAGGCACTGAAGAATTCACTGACAAGGTTGGCAAAGTAAGAAGGG ACAAATACCCTGCTATTTTTTTGTTATGGTTGTGGTTTTGAGTGAAGATA CGTGCTGACCCAAGCAGAGGACTGTTAGTCCAATGTTTCTATTAAAAACT ACCATCATAATCAAAACACCAATAGGAATAACTAAATTTATCAAGCACTT ACTAAAAATAGAATACTGCTTTAAGTAGTCTGCAATTAATCCTAACAACA CAATATAAAGTGATGCTATATTAGGTGGAGAGAGTATCAAGGATCAAGAC TTATTTTCATAGTTGTGGGGAGCAGGTGGGATCCATCTATCTATCTACCT ATCTACCTATATCTATCTACCATTATTATTATCTATTTAAACTCTCATGG GCTACTTGAAGATGCATAAATGATCATATATTGAATTGTATGATTAGTTG TAATTCAGAATCTATTTTATTTAAGAGAATGTAATGTGACAGCCTCGTCC TCAGCTCTCTCTCTAA project fbnw AK 20040830 7076bp TAGAGCAGAGAATGTCTGAGACACATTTGACTTCAGTGTTCATGCTTTTT GACCTCCAACACAGAAAACTATGGTGCATAATTTGGGAATTTGGTATATT CACATCTGACATATACACTTAGAGTGCTAGGGGGGAAAAAGTGTTAGAGA AAAAAGAGGGTCCTCTGTCCATGGAATTCTCCAGGCAAAAATACTGTAGT GGGTGTTCATTCCCATGTCTAGACGATCTTCCTGACCCAGGGATTGAACT CAGGTCTCCTGCATTGCAGGTATATTCTTTACCATCTGAGCCTCCAGTAA ACCTAAGACCAGGGAAACATCCCTTAAAAAGCATGTAAACATCCCTTAAA GAGCATGCTGTAAGTCACTTCAGTCGTGTCCGACTCTGTGCGACCCCTGA GATGGCAGCCCACCAGGCTCCCCCGTCCCTGGGATTCTCCAGGCAAGAAC ACTGGAGTGGGTTGCCATTTCCTTCTCCAGTGCATGCAAGTGAAAAGTCA AAGTGAAGTCTCTCAGTTGTGTCCGACTCTTAGCAACCCCGTGGACTACA GCCCACCAGGCTCCTCCGTCCATGGGATTTTCCAGGCAAGAGTACTGGAG TGGGGTGCCATTGCCTTCTCCGTTTCAATTCATAAGTTCTTTCAAAAATC TCCCCAGAAAAATAAATGACGCAATCAAAAAATGGGCCAAAGAACTAAAT AGACATTTCGCCAAAGAAGACATACAGATGGCTAACAAACACATGAAAAG ATGCTCAACATCACTCATTATCAGAGAAATGCAAATCAAAACCACTATGA TGTACCATTTCACACCAGTCAGAATGGCTGCGATCCAAAAGTCTACAAGT AATAAATGCTGGAGAGGGTGTGGAGAAAAGGGAACCCTCTTACACTGTTG GTGGGAATGCAAACTAGTACAGCCACTATGGGGAACAGTGTGGAGATTCC TTAAAAAACTGGAAATAGAACTGCCTTATGATCCAGCAATCCCACTGCTG GGCATACACACTGAGGAAACCAGAAGGGAAAGAGACACATGTACCCCAAT GTTCATTGAAACACTGTTTATAATAGCCAGGACATGGAAGCAACCTAGAT GTCCATCAGCAGATGAATGGATAAGAAAGCTATGGTACATATACACAATT GAGTATTACTCAGCCATTAAAAAGAATACATTTGAATCAGTTCTAATGAG GTGGATGAAACTGGAGCCTATTATACAGAGTGAAGTAAGCCAGAAAGAAA AACACCAATACAGTATACTAACGCATATATATGGAATTTAGAAAGATGGT AACAATAACCCTGTGTACGAGACAGCAAAAGAGACACTGATGTATAGAAT AGTCTTATGGACTCTGTGGGAGAGGGAGAGGGTGGGAAGATTTGGGAGAA TGGCATTGAAACATGTAAAATATCATGTATGAAAAAAAAAATTATACTTC CAAAAACAACAACAACAACAAAAATCTCCCCCACCTTCGATTTCTGAATG CTCTTAATCAGGTCTTTCTCACCCCTGGATCATTTAATAAGGTCTACTAT TGTACAGGCCATTTGCACTTGAGTGAAATACAAGCAACGATCCTTTGAAG ACCTTTGAGCTTAAAATTTGATATTTTAAAATTGTGTGAAACCCTAAAAT CTTAACAGAGTGACACAGATAATTAGATGCTTAAAAAATTACTCAAATGT CAGGCAATAAGTCTGTTCTACATTGAAGGTCTAGGAACCTGGGATGAGGA ATTCCAAGCAGTGATCTCTCAGCAATGGTAGCTACATCAAACTGCTAGAG AGGCAAAGTGACTTTGTAAGCCAGTCTTAGGACCTTCAGACTTTAGGGAA GAAGTGAATAACATCTGATGCAGGAAAATGTTTGACAAAATTATTTTTAC AATTCCAAATATGTTTGAGAAATATTTCAAAAATGTTTGAAAAAATTATT TTTACAATTAAAAGGAATGTACGGACAAGTTAAAGGAAAACTCATATAAT TAGAATGAACCATAGGAGTTCTGTGCACATTGGTAAACCCTCTTGTGGAG CTATTTCCTCCTTCTCACATTTTTTTTAAACTGTATGAAATAAAAATTAT AAACGTTTTCAAAGCTTACATTGTTACAAAAATGTAATCCACATGATTCT TGCATCGAATTATTTTGAGATTTTATTAGAAATGCAACTTTTTAGATTCA ATCCCAGACCTGGCTGAATAAAAATCAAAAGCGGTTGAGTCTGGACAGGG GCCGATTTAAACATCACAGGTGAATTTTGTGCTTCTGAAGATTTAAGAGC TGCTGGAATAGAGACTACATATGGCCCAGAGAACATTAAAACAACATTAT ACCAGTTCATAAATATATATGTGTGGTCAGTTGTGTATTGTATATACACA TATGTATATGTATATGTGCACATATATGTGTGCTCAATTGCTCAGTCATG TCCGACTCTTTGTGACCCCATGCCAGGCTCCTCTGTCCATGAAATTTTTC AGTCAAGAATACTGGAGTGGGTTGCCATTTTCCACTCCAATAGACATATA CACATGTATACACACACACATATATGTATATACATATGTATGTTTCAAAT TTAAACTGTTGAAATTGCAACAGTAAATTATGAAGTGATAAAAATTACAA TAATACAGAAGATATAGCATACTATTTTTTTCAGATCACTTGCCTGGAAA AGGATAAATGAAAGAACATATTAATTATACATAAAGCACATTCACATATA CTCCTTAATATATACGGTGATAAAGCCAAATGTTTCTGAGTTCAGCTTTC TCATTCCCACTGGCTCTATCATTAACACCCAAGCCCCAGTATTCACACCC ACTCCATCCTCCTCTTTAAAAGTAACCACCAGAAACTACATGGGACTCAC CACATCTCATTGCTGAATGTGGTGAGCAACATTCAGCTCAATTTTGAACC TAAAAAGCCTGGGAAGCCTGCTTTATTTATGTCCTCTGGGGCCTCACCAA GAAAGTGTTGCTATTGCTGCTGCTAAGTCGCTTCAGTCGTGTCCAACTCT GTGCGACCCCATAGACGGCAGGATCCCCCGTCCCTTGGATTCTCCAGGCA AGAACATTGGAGTGAGTTGCCATTTCCTTCTCCAATGCATGAAACTGAAA AGTGAAAGTGAAGTCGCTCAGTCGTGTCCGACTCTTAGCAACCTCATGGA CTACAGCCTACCAGGCTCCTCCGTCCATGGGATTTTCCAGGCAAGAGTAC TGGAGTGGGGTGCCATTGCCTTGGGCCTGCTCTTTCACCCTGATTGCAGT CGACGGCCATCCTCACACCATCATCATTCCTGCCATTGCAGTTTATCTCT TGATTTCCTTGAGTCCTAATACTCAAGTTCAACCATAAGTTTTCCATCCT GATTCAAAGCCTTTGATGCAAATAAAGAGATACTAAACCACAGAATATCC ATGGGGAAAAATTAGGGAAGAAATACAAAGTATACATTCTAAACCAAATT AAGTTGACATTCAGTGCAGCCTCATTCATACCGTGTGAGTGCTAAGTTGC CTCAGTCATGTCCAAATCTTTGTGACCCTATGGACTGTAGCCTGCCAGAT TCCTCTGTCCATGGAATTCTCTAGGCAAGAATACTGGAGTGGGTTGCCAT ACCCTCCTCCAGGGAACCTTCCTAATCAACCCAGGGATAGAACCAGCGTC TCCTGCAGCTACTACAGTGCAGGCAGATTCTTTACCACTGAGCTATGGGG GTGGGGGTGGGGGGGGGACAAAGACCCATTCATACCCTATAAAAAAGCAA ATGCCATACTGTTTTTTCACAATCTGTTTGGTGGGGAAAGTTTTTTTTTA ATAATAATAATGATGACAGCTTGTACTTATATAGTGTTTGACAGTTTTGA AAATGTTTTCAAATATAGATACATTTAAAATATATATTCGATCTAAAATA AAAATATATTTGATCTAAAATAAAACCAAGTTAGGGAATGCATTATCACC ATTTCTAAAATAAGGAGACTGATAGGATATTTCTCTTAGTTCACATAGGT ATTAAGAGTAATCAAGCCTTATTCAAAATCAGATTCCAAATCCAGAAAAT TTCCTTGGAATTTATATTTTAAGTAGGGAATCTTAGGACAAAAAAAAAAA AAAAGGTAGTAGTCAAGATAACCATAGGTGAATGTAACGAGATTTTGGCA AATGTATTCTACTTGTTCATTCTGATGTCATGTTGTCTCACCTGGATTAA TTTTTTGCCAGCCTTGAAAAGCAGTTGTTAACAACTTTGTCTTTTCCAGG GTATGATAACTGTGAAGTCTAAGATGAGAAAAAATGTGTGAGATATATTT AAAGATAATATTAAATACCTTATAGGACTTCTTTAAACAGAGAATTTACT GAATAGATTTTTATCCTTATATAATGCTTTGTGCTTATTTGATGTTTATT GGAAATATAGAACCAATTACAAGTGCTATATTAAGAGGTCAACATTTTGA CGCTCAGAAGACATGATAAAGTGCTTCAAGATTTACCTATACCATCACCA GGAGAACAATGTAAGCTATTTTAGACGTAAGAGTTTACCAATATATAGAG TTCAAGGGTTAATCTAGAAAAAATAAGGAGACTGTTTCAATTTAAAAATA TTTTTATGCAGCTAAATGTATACACTTAAAAAGCAATGACTTGAAATTAG AGTATAATTCAAGTGCAGTAGGAAGTTGAGATTTACAAAATGTTTCAAAC ATACAAATCACTCTTTATACTGCTACCTCATTGCTAAAAGAGAAGATAGA ATCAAATTATATGAAAACTACAGAAAACTAGATCAAGGAATCTTTTTTTA GAATGGCATGTCTTCAGCAACATGACTGTAATACTTACAAACTCAGCAAA CCTCTAAGCTTTCCACTTTTTCGTTGTTGTTTGTTTGATTTACTATGAGT GTATCCTTTTATTGATGGAACACTACACCACTGAAATATTTTATAGGAGA GTCTATTTCAGAATCCCTGGAGGTTTAAATAACTTAAAGTCACTCTTTGA AGAATAGCAATTGACCTCCGAATGGGTCTTACTTGAATGTTCTTTACTTC CAAAAGAAATCAGAGCACCAGGAAGATTTAGAAAGTCAATTTTTATAGAA AAATGGAACAGTAATTTGTCCAATAGTTTATGTCAATAGACAAAAGTAGA ATATGACTTATGCCAAATTTCAACTGAACTAGAATTAAATATAGGATTCT CAGCTTACATGAAGGCTAACCTGTATGATACATAATCACATTGAAATAAT ACAGAGATCCATGGGCTTAGATATAAATTATGGAAATAGAATCACTATGC AAATCACGTGAACATTTTCATGGAGTGAAAATAATATTGTGTCTCTGAGA AATTCCCTCTTGCAAATCCACATAATCCATTTCTTATCATATGTGACATT TATGATAGGATTTGGGGATGTAGAGTAAGGGGAGTCGAATTGGTATTTGG CAAGTGACATTTCAAAGTAGGAAATTAAATTACAAAGAGGCTAAATGTAA GCCACAGAACCAAGGGGTTCTGTAGCAGAGGCTCCAAAGTCATTTTCAGT CTGCTCTCTAAAGGATCATTTCATAGTTTATGCAGAAAGCCCTAAAATTC AGTGGTAATTAACAGAAGTTAATCCAGATGACTGTCTGTGGAATAGTCGT CATGAACTTCCACCATGTGAATTAACTGTCTATTGTGAAGAGAAAAAGAC TATTGTGGAAGTAGATTCATCACACAGACAAGAGATATAGAATTGTCTAT TTCACACTGATCAGCTGCAAAGTCATCTCACTTCAGCAAATGTCCGACCA AATGACACAGAATGTTTATATTACAAGTTATGCAGCCAACTTACATCTTA CTTCTGTAATATCCATCACTGTCAACATTAAGTCCTCTATAATTTAGACC TTGCAGGAGTGTTGCTATGTTTTCTAAATTAATTAAAGAGACAAATTTTG GGCCCATTGAAATCTGATAATATCAAACACTGGTATGAAAAAACCTTGCT TGTACAGGTCTACAAGTAACTTTTCATGGTTATCTGAATAACCCGAATGC ATGACTCCTTGTTTAGAGCTTCAAATATTAAATTTGGTTTTATTAAATAT TTATGATATCAGCATATACTTTATATTATAAATATCACAGTATTTGTGAT TTATAGCATCATAATGTATCGATTACAACATTGACAACTTCCCAAAATCT GAAACTAAATAAGTTTCAAAATTTGATTTTATTCATTAATAAGAAAGTTT TATAATAGTCAAGATAATTAAAAGCTGTAGTACAAGAAATCTAGAAGTGT CCTTGGAAATTATCTAAGCAAGTCCTCTTGTTTTATAGCTGAGAAAACCA AGACACAAAGATATTCAGGTGAAATGCCCAAGTTTGGACAGTTATTTGGT AGCAAATCATATANATTTAACCTTAATGGAAGATTTTAGATTAAAATAAA ACTTACTAACATGTTCTTAACATAGATTTAAGAAGAAAGTAGAGGCTTAT AATACATCAAGAGCATGATGAGCAAACATTTTACATATAAAAAATATGCT CCGTGGGGAAATATCTCCTCATCACGTTCCTGAAGTATCATAAAAAATAG CCAAAAATTCATTTTTATTCTTCCCAAACACTGATGGGCATTCTAATAAC TCTTTTATTTGATTCCTTTGGTACCACCCCTCTAGGGCTTCCTTATAAAA AAATTTCCTCCTTGGTATATTTTCATCCTCCCTTGGGAAAGGGAAATTGC TCATCCAGGTCCAACCCTTTTCAACCCCTGGGAAGGGACCCTAACAAGGT CCCCTCTGGCCCAGGGGAATTTTCCAGGACAAAAAAGGTTGGAAGGGGGT TGCCCTTTTTCCTTTTTCCCGGGGGAGACTTTCCCCCAACCCCGGGAAAT TGAAACCCCGGGGTCCCCCCCCATTTGGTGGGGCGCAAACCTTTTTCACC CCCCTAAAACCCCCCCCGGGGAAAAAACCTCCTTCCTCCTTTATAGAAGG GAACCCCACAAACAATTTCACCTCTA project fbnw AL 20040830 6616bp GGGGCATGATGGTACGTAGTTCTCAATTTTGTGCTTGTTTTTGGACTTAC ACATTGAAATTCTAGGAATCGTTGCAAATTAATACTCAGTTCAGTCGCAC AGTTCAGTTACTTAATTGTGTCAGGCTATTTGCGACCCCATGAATCGCCG CACGCCAGGCCTCCTTGTCCATCACCAACTCCCGGAGTTTACCCAAACCC ATGTCCATTAAGTCGGTGATGCCATCCAGCCATCTCATCCTCTGTCGTCC CCTTCCCCTCCTGCCCCAAATCCCTCGCAACATTAGGGTCTTTTCCAATG AGTCAACTCTTCACATGAGGTGGCCAAAGTTTTGGAGTTTCAGCTTCAAC ATCAGTCCTTCCAATGAACACCCAGGACTGATCTTTGGGATGGACTGGTT GGATCTCCTTGCAGTTCAAGGGACTCTCAAGAGTCTTCTCCAGCACCACG GTTCAAAAGCATCAATTCTTCAGCGCTCAGCTTTCTTCACAGTCCAACTC TCACATCCATACATGACCACAGGAAAAACCATAGCCTTGACTAGACAGAC CTTTGTTGGCAAAGTAATGTCTCTGCTTTTGAATATGCTATCTAGGTTGG TCATAACTTTCCTTCCGAGGAGTAAGCATCTTTTAATTTCATGGCTGCAA TCACCATCTGCAGTGATTTTGGAGCCCAGAAAAATAAAGTCTGACACTGT TTCCACTGTTTCCCCATCTATTTCCTGTGAAGTGATGGGAAAAGATGCCA TGATCTTAGTTTTCTGAATGTTGAGCTTTAAGCCAACTTTTTCACTCTCC TCCTTCACTTTCATCAAGAGGCTTTTTAGTTTCTCTTCAAATTAACATTC ACAAAATTCAAATCATGCCAATTTGACTTTACAATATCAAATAAATGATA CGCTTATGTAGGTACTCTAAAGGGTCATAAGAAAAATAACCTCATGCTTG TTGAGAAGCTTCATTATGTTGCCGCCCAGCTGTCACGTATGATCTCTATG TGTGACTGTTTGTTCTGACCATAGATTGAAGGTTATAGTGAAAATTCACA CCGTTTGTACTTATTTTTCTCTCAGGGAAAATAAGGGGACTCTAAAAATA ATATTCACACAAGGTTATCAGGCAGCAAACTAGAATTTTCATTTCTGTAA ATGATAGTGTAAGTTATATCCTATTATATTTCTATTTTGATAACAATATC TATGAACTGTGCCTGGTATTTCCCACTTTGTCCTACATGTTTTTACTATC TATGTCACATGACATTATTTCCTGTGGATCTCCTTGTAGAAATTGCTTCG ATTCCCTTTTATTAGTTCCAACTGGACCCTCTGGTATTTGGCTCTCCAAA TTCTGTGTGCATTAGAGGCAGCAAATATAAATGGTTTTAACATTTATCCC AGAAAAATGTTATGTATCTAATCACTGGTAGTTATTATTGGTGATTCTAA TAGCATTATTGATAAAGTATTTCAAATCAATACATTTAAAGTCTATTGAA TGGTGACTTAAGAGGGCATTGTCATATTTGATTGCTGTTACAGACTGGTA TAGCTCTATCTCTTCAAAATAGCAATTAAATAATTCACTTGTTTTCTACA TCCTGCTTATTGCTAAATGTATCCATTTCCTCAGTTTATGAAGAGTGGGT TGGTTTGACCAGGCCTTTCCTGCATTGTTTGCTTGTTTAATTCCTTGGAG TTCTGGAATCCCTAACTGTTATTCTGCCAAACACATTGCTTGAAATTCAA TAGACTTGTTTTTAGATGGCTCCCGTCTTTCTTCTTAAAGGACATGTGCC TGATTGCCAAGGCCAACATATTCTAGAAGCCATTGTTTGATATCAACACT AAAGTAGTTCACTACCATTGGAGTTGTGTCAGTCATGTTTTTTTCTACTT ATTTTTGTATTTAGGAGTATTTTCTTTAGGCAGAAGTAGTCCTTGTTCTT GCTTCTCTTTTACAGCTTTTAATGTATCTACCTAGTTATTAATAATTCAT TTGAGATTCTGTAAAAGGAAGATGTCTCCTCCTTCTTTAACAGATATGAA GCTGAGTTCACTTCTTAACCATCTTAAGATGTATACAACAAATGCTAATT CAAGTGAAATAGCACTGCTTTTTAAGTTAAAATGATTCCACAGATAACTT CATTGGTATGAGTATCTATTCTATGGATAGTAAAAGCCATTCTGTCATTG TTATAATTATATTAATAATTGTCTGCAAGTTATTTGCAGCATTATTTACT CAGTTGGTTCAGTGTTAGATGTTTATATATTTTTGAGAGTGGGAAGTAAA ATAATCACTTCTGCTGAACTGTGATGAAATTGCACCTGTCAAAATATGCA TTATTTTGCAATGAATTAATGGAAAAAGTAAATATTTTCTTACTATAGAG TATATCATATCATTGTAACCTTCCTGCTTTTCCAAAAAAAATTTCACACA CGCACACACACACATACACATAAGTACATAAAACATAAATATAGAACTCA ATGATTTATGACAAAATAGAAACCCAAGTAAATACCACTAGATCCAGAAA GAGAACACTCAGTTCAGTTCAGTTCAGTCACTCAGTTGTGATTGACTCTC TGTGACCCCATGGACTGCAGCACACCAGGCTTCCCTGTCCATCACCAGTT CCTGGAGCTTGCTCAAACCCATGTCCATTGAGTCGGTGATGCCATCCAAC CATCTCATCCTCTGTCGTCCCCTTCTCCTCCTGCCTTCAATCTTGCCCAG CATCAGGGTCTTTTCCAATGAGGCAATTCTTCCCATCAGGAGGCCAAAGT ATTGGCATTTCAGTTCCAGCATCAGTCCTTCCAATGAATATTTAGGACTG ATTTCCTTTAGGATGAACTGGCTTGATCTCCTTGTAGTCCAAGGGACTCT CAAGAGTCTTCTCCAACAACACAGTTCAAAAGCATCGATTCTTCGGCAAT CAGCTTTCTTTACAGTCCAACTCTCACATCCATACATGACTACTGGAAAA ACCATAGCTTTGACTAGATGGACTTTTGTCGGCAAAGTTATGTCTCTGCT TTTTAATATGCTGTCTAGGTACGTCATAGCTTTTCTTCCAAAGAGCAAGC ATCTTTTAATTTCATGGCTTCAGCCACCACCTGCAGTGATTTTGGAGACC AAGAAAATAAATTCTCTCACTGTTTCCATTGTTTCCCCGTCTATTTGCCA TGAAGTGATGTGACTGGATGCCATGATCTTAGTTTTCTGAATGTTGAGCT TTAAGCCAACTTTTTCACTCTCTTTTCACTTTCATCAAGAGGCTCTTTAG TTCTTTTTCACTTTCTGCCATAAGGGCGGTGTCATCTGCATATCTGAGGT TATTGATATTTCTCCCAGCAATCTTGATTTCAGCATGCGTTTCATCCAGA CTGGCATTTCTTATGATGTCCTCTGCATAGAAGTTAAATAAGCAGGGTGA CAATATACAGCTTTGACGTACTCCTTTCCCAATTTGGAACCAGTCTGCTG TTCCATGTCCAGTTCTAACTGTTGCTTCTTGACCTACATACAGCTTTCTC AGGAGGCAGGTCAGGTGATCTGGTATTCCTACCTCTTGAAGAATTTTCCA CAGTTTGTTGTGATCCACATAGTCAAAGGCTTTGGTGTAGTCAATAAAGC AGAAGTAGATGTTTTTCTGGAACTCTCTTTCTTTTTCAATTGGTCCAACA GATGTTGGCAATTTTATCTGTGGCTCCTCTGGCTTTTCCATATCCAGCTT GAACATCTGGAATTTTATGGTTCACATACTGTTGAAGCCTGGCTTGAAGA ATTTTGAGCATTTCCAGCATCTCAAAAGCCATGTTTATTCTTCTCACAAT CATGATCCACCTCTTTTCTTAAGGTGAAGACTATCCTGACTTTAATCACT ATGGTGTGTTTTTTGCTTGTTTTTATTTTTATGTAAATGTTAATAACTTT CTAAGTGCCCTCCTATGTCTTACTTTTTTCCCTCAGGATTGTCTTCTATT TATGGCCATGTAGCAGCAATTTATTGTAATTGCCTTGTTGCATTTTTAAA TATAAATGCACCATAATTGTATTTATCTTGTCTATGTTGATGGTCATTTT GATTATTTTGATTATGTCAAATTTGGGTACATAATAGTAAGCAAGTTGCA GTTATAAGTAGTGATGATATTATCAGTCCAAATCTAAGAATTTGATAGAT AATTCCAAATAATTTTCCAGAGTGATCCAATTTAAACTCTAACTATTGGG ATTTAAGAGTTCCTATTGCCCCACATCCTTACCAACTATGTTAGCCATAA AAGCCAGTCTGTGGATTGCTTTTTGGACTCTTTAATTAATCAATAAAACC TGATTTTAATATATTCTCATTTTTTGGTATTTTCCTTTAAGATAATTATT TTTTGAGTATGGTCTATTTAAGAAATCATAGAAGCATTTTTATATTCTCT CTTATATATTCAAAATTCCCAAAAGAGGAAGTCACATAAAAGAGAAATGT CCTGTTCATATACACTTTCACATGAAGAAACTAAGAAGCAGCAGAAATTA CAATTTGTATTTTGGATTTAGCTTTACTTTTCATTTTTTCAACGTCATTT GGCCTTGATCTACTTTCCGTCTAGTAAAAGCCTTTGAAATTTACCTGTTT TAAATAACTACATTTCAGTTTAATGAGAATAGACTGGGTAGCTGGTAGGG AATTTTTCAATCTGAGAAGCTAATAAACAATTCTATCCTAAAAATGTTCT ATGTTTGAAGCTCAAGAGAAGAAATCAAGTAGGATTCAGGACTAGGAAAA AGGAGTACAAAAATTAGGTGACAATACTGGATGACAATTTCAGTCGGCAA TAGTATTATTGAAAAATTAATTAAGGGAATTATTAAATAATATTTGATAC ACCTACATTTTGAGGTAAAAAGACACATTTTCATCTCAACTATCAACAGG GTCAGTTCAATTCAATTGCTTACTCGTGTCTGACTCTGTGACTCCATGGA CTGCAACATGCCAGGCCTCCCTGTCCATCACCAACTCCCAGAGTTTACTC AAATTCAAGTCCATTGAGTTAGTGGAGTCCAACCCACCAAGTCCACCTCA CTCCAGTACTCTTGCCTGGAAATTCCATGGATGGAGGAGCCTGGTAGGCA GAAGTCAGACATGACTGAGCAACTTCACTTTCACTTTTCACTATCATGCA TTGGAGAAGGAAATGGGCACCCACTCCAGTGTTCTTGCCTGGAGATCCCA GGGATGGGGGACCTTGGTGGGCTGCCTGCCATCTATGGGTTCGCACAGAG TCTTAACGATTGAAGTGACTTAGCAGCAGCAGTAGCACATACAAATATAC ACACATATAGAAGCTCTGAGTTTAGAAAGACTTTCATTTATTATTCTATG TAGATAACTAGATTGAATGAAACATATCAATGTGTTGCAGTAAAGTTTCT GATATCCAAAATAGACAAAACAGGGTAAAGAACATCCCTGAAAGAATTCT GTTTTAAAAAGACTAGTAATTCTTTCTGTATCACATACTTTAACAGAGAA TTAATTATTCATCTCCTTCAAGGGTGGAAAAAGTACAACCCGCATCTTTA TTCAGGTAAATATTGAAAATAAAGACAAATGGTAGCTTGACTAACAAATA CTGAATATCCTTCTCAAAAGCCCCAAGCTTACAAAGGCTCAGTCTTATAT ATTAGGCAGGACCCATAGATATCCTCAACTGGTAAATCCCCACTGATTAT TTTCCATAGTGATGCATAAACACAATTTTCAAAAAAAAATAAATAAATAA ATAAAGGAAAACCAAGGCATCAAAAAGAAAATTTAATGAAAAGCATTTAT CACACAGCTGCCTCAACTATAGTTCTTTTTAGAAACAAGTACACTTATTT TTTCATTTGTTAAATTTCCTTATGTTTCTTTCCAAATCCTCAATATCAAG CTTATACTGGTACTTCATTTTTATACACATCAGATACTGATAAAATTTAG ATATTTTCTGTTGACATTTTTTACTGACATTTAGGCATAGTCCTGAATCC TACTTGATTTCTTCTCTTGAGCTTCAAACATAGAACATTTTTAGGATAGA ATTGTTTATTAGCTTCTCAGATTGAAAAATCCCTACCAGCTACCCAGTCT ATTCTCATTAAACTGAAATGTAGTTATTTAAAACAGGTAAATTTCAAAGG CTTTTACTAGACGGAAAAGTAGATCAAAGGCCAAATGAACGTTGAAAAAA TGAAAAGGTAAGCTAAATCCCAAATACAAATTGGTATTTCCTGCTGCTTC TTAGTTTCTTCCTGGGAAAGGGGAATAGGAACAGGAACTTTTCCCTTTTT TGTGACTTTCTCTTTTGGGGAATTTTGAAAATTAAAAGAAAAAAAAAAAA AAATGGCTTCCATTGAATTTCTTTAAAATAAACCCAATACTCCACAAAAA AAAATTTTATTTTTAAAGGGGAAAAAAAACCACAAAAAAATGAAAAAAAT ATATTATATAAAACCGGGGTTTTTTTTTTTAGATTTAATTTAAAAAAAAA ACCCCAAAAAAAAAGAAAAACTCCCCCAACAAAAAGGGGGGGGTGTTTTT TTTTTGGTGGGGTAAA project fbnw AM 20040830 5325bp CATGAGAATAATAATTCTTTTTTTCTATAAAAGGCCCCAAAAAAAAAAAC CACACCAATTTTTATTTTCTCTCTATATTGGTATGTTTATGTCCCTTGAA GTTGTATTTCAGAATTTTTTGTGGGACCCCCATTGAGCCATAAAGCTCGC CAGGGTTTTTTTCTTTCCTGTGGTTTATCCCAGGCCGAAAATATCGGGAA TTATTTTCTCAAGGGGATTTTCCTTGACCCCGGGGTTTGGACCGCATTTT CCTACAATAACCGGCGGGTTTTTTACCCAATGAATTCCCAGGAAGACTTT TCATTTTTAGCAATTGTTTTTAGGTGATTATGCGACCAGCCATGGTAGAA AGTTTTAAGGGATAGGCTTTAAGGGGGGTGTTTTTTCCTAAGAAACTCAA TTTTTGGGCAAATGCCAGGAAATAGAAAGTTTTCAGGCAGGGGGAGAAAT TCCAAGAGATAGCAAATTACTAAAAGTAACACCGTGTAGAATGGACAGAT ACTTCTCTCTTAATCCCTGTTGCTGGCAATGCTAGTTTAGTCCCTCATAC CACTTGAGACTTCCACAATACAAATCCCATTCCTCTTCCCTCACTACTTC ATTTGCAGTCTCCAAAACACCATCAGAGCAATATATTTATAACTGAAATC CCCTTCTTCATGATTCCTCATTGTCCATAGCGATGTGTTCTCCCCTAGTC ACACAATACCCAAGTTCTAGATATTGTAGCTCTATACTGAATCTCTGGAA GTTGTTCACTGTGTGCCTGCATGCTAAGTAACTTCAGTTGTGTCTGACTG TGTGTGACCCTGTGGACTGTAACCACCCAGGCTCCTTGGTCCATGGAATT CTCCAGACAAGATAACTGGAGTGGCTTGCCATGCCCTCCTCCAGGGAATC TTCCCAATCCAGCGACAGAACCCACTTCTCTTCTGTCTATTTGCATTGGC AGGTGGGATCTTTTCCACTAGCACCACCTGGGAAGCCCCAGAAATGGTTC ATTTATGCTCATTATAGAGCACACGTATATATAAAAACAAACCTATTTGT AAAATGCTCAATACTAGATCTTTTTTTTTTTTTCTGGGTAGTCAAAATAT GTATTAATTTATGACAACTTACGGAAGTCTGGCAGTTAGAACACCCGCTT ATATTTTGTTTTCTCTGGCCTGAGAATTTGCTAACTGTCTATGATTGCAA AGTCCCCTTTTAAGATTTACTATTATCATCTTACAGGGCTGTATAGAGAA TGTTTTTGAAATCTCTGACCTGAATAATCAAATTTGAGTTTCTTAACACA TTCAAGATCCTCCATGTGATAGAGCAGCCTCTGTCTCTGAAACCATTCCT TGCCACTGAGTACTTCAAGCAAGTTGGTAATTTGGGAGGTCATGTCATAG TCAGGCTGGGATGAGGAGGCTACAGTAACAAGCTCAGATAGGAGCACAGC CCTGACTGTTTCCTCCACTTACACAGTCAAAATATTTAATAACTGTTAAG GCACAGTCATGATGAACAGTGACTTGTCAGAATGAACAGTGACTATAGTG GCAACCCCTGTAGAAGTGTGCCACACCCTATTCCTGACTGATACACGTGG CATCGTGGAGTGGAGCTCATACAGATTCCTTCTGCAGGAAGGATCTGCAG GTGAGATCTCTTATTGGATAGTAGAGAGATTTCTGAGCTGAAAGGTGCAA ATAGGGTCTCACAGCAGCAATTATTTCAAACATTTTCCCAGCTGGTATAG TTGTCATGATGTATAATAGTTAAATGCAAGTCCTACCTCATGTCAACCCA ACCTCCCCTCAAGTCCCAATCACTAAGCTAGTAAAGTACAAGACAGAGGG AATTTTATGAAAGACCAGTTGCTTAGGAGTAGTTTCTGGAAGGTTTTCTG CAGTGCAGTTTTGCTTCATTAGGTGTCAGGGAGGTAGAGAGTGAGTAAAC TCAGTTAGTTACCTACAAGGCTCTCTGTCCTGAGACGTACTCTTCACCTC CCTCTCCCCTTCTTCCTCTAAGGAATGCTCCAAGTTCCTTTCTTGGAGGA GTACAAGTTAAGATATTGATTTTCCATTTCTCCTTACGGGTACAAATGCT TATGTGGCTGATGAATCTCAGAAAGAAAACTGAACCGTGTATGAAAAAAA AAAAAAAAAAAACAAATTGACAGACTAGACACAATGGGAATTTAAAATAA ACTTCTAAGAATTAAATTATATTGGAAGTACGAGGAGGAAGCCAGAATTT AAAGAAACAAGTCATCTTCAATTGCAGAATGTTCCAGTATTTTTCTCATA AGACAAAAATGCTATGTATTGATCTTTCAGTGAGTTCAGTCACTCAGCTC AGTTCAGTTCAGTCGCTCAGTGGTGTCTGACCCTTTCCGACCCCATGAAT CGCAGCACACCAGGCCTCCCTGTCCATCACCAACTCCCGGAGTTCACTCA GACTCAACGTCCATTGAGTCAGTGATGCCATCCAGCCACCTCATCCTCTG TCATCCCCTTCTCCTCCTGCCCCCAATCCCTCCCAGCATCAGAGTCTTTT CCAATGAGTCAACTCTTCACATGAGGTGGCCAAAGTACTAGAGTTTCAGC TTTTGCATCATTGCTTCCAAAGAAATCCCAGGGCTGATCTCCTTCAGAAT GGACTGGTTGGATCTCCTTGCAGTCCAAGGGACTCTCAAGATGAGTCTCC

    Original URL path: https://www.hgsc.bcm.edu/ftp-archive/Btaurus/fasta/BACs/project_fbnw.fa (2013-03-31)
    Open archived version from archive